ORFeome > smarce1 – XORFeome 2.0

smarce1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1, mRNA (cDNA clone MGC:69429 IMAGE:5335681), complete cds
Gene Symbol: smarce1
Gene ID: 448018
ORF gb_acc: MG133404
ORF ID: 10914

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074534

Library Location

Plate ID: GDExt11008
Well Location: B10

EST Sequences

Clone: MGC:69429 IMAGE:5335681
Trimmed Sequence: ATGTCAAAGCGACCATCATATGCTCCACCTCCAGCCCCGGCCCCCACTACACAAATGCCCAGCACACCAGGGTTTGTGGGATACAATCCATACAGCCATCTTGCCTACAACAACTACAGGCTGGGAGGGAACGCAGGCAGCAACAGCAGGGTAACGGCTTCATCAGGCATTACAATACCAAAGCCACCTAAGCCTCCAGATAAGCCACTGATGCCCTATATGAGATACAGCAGGAAGGTCTGGGACCAAGTGAAGGCTTCCAACCCTGACCTTAAGTTGTGGGAGATTGGCAAGATCATTGGTGGGATGTGGCGAGACCTAACCGATGAGGAGAAGCAAGAGTACTTGAACGAATATGAAGCCGAAAAGATTGAGTACAACGAATCAATGAAGACTTACCACAACTCTCCTGCTTATCTTGCCTACATCAATGCCAAAAGCCGGGCTGAAGCTGCCCTCGAGGAGGAAAGCCGCCAGAGGCAGTCGCGCATGGACAAGGGGGAGCCGTACATGAGCATCCAGCCGGCCGAGGATCCGGACGATTATGACGATGGTTTCTCCATGAAGCACAGCGCCGCTGCCCGTTTCCAGAGGAACCACCGGCTCATCAGTGAAATTCTCAGCGAGAGCGTGGTGCCCGACGTCCGCTCCGTGGTCACGACCGCTCGAATGCAGGTTCTGAAAAGACAAGTTCAGTCTCTCATGGTGCACCAGCGGAAGTTGGAGGCAGAATTGTTACAGATAGAGGATCGCCACCAGGATAAGAAGAGGAAATTCTTAGAAAGCACGGAGTCCTTTAACAATGAGCTGAAGCGGCTGTGTACTTTAAAGGTGGAGGTGGATATGGATAAGATTGCGGCAGAGATAGCCCAGGCAGAAGAGCAGGCAAGGAAGCGCCAGGAGGAGCGGGAAAAGGAGGCCGCAGAACAAGCAGAGCGCAGTCAGAACGCAGCAGCCGTGGCGGCAGCAGCAGCGGCGGCGGCAGCAGCTGTGGCAGCTGTGGCGGCTGCTGAGGAAGAGCAAGAGCAAGAGGTGGCAAAACCAGAAGAAAAGAGTGAAGAGGAGGAGGCCCCTATGGAGACAGAAGACACCCCATCCCTGCCCCCAGCAGAGGAAACCAGCGAGAGCCAACAAAATGGCGAAGAGGGGACCTCCACCCCCGACGACAAGGAGAGCGGGCAGGAGGCGGTGGACAGCACCCTAGATGAAGGTACAAGCGACAGCAACACTGGGTCGGAGAGCAACAGCGGCACCGTGGAGGAACCCACCACAGACTCTGTAGCGGAAGAGACCGACCGCAAGAACTGA
Full Trace Sequence: gggcagagcggggtgtgaggttctatgggagaggactgaataaaatctgcgaaaatgtcaaagcgaccatcatatgctccacctccagccccggcccccactacacaaatgcccagcacaccagggtttgtgggatacaatccatacagccatcttgcctacaacaactacaggctgggagggaacgcaggcagcaacagcagggtaacggcttcatcaggcattacaataccaaagccacctaagcctccagataagccactgatgccctatatgagatacagcaggaaggtctgggaccaagtgaaggcttccaaccctgaccttaagttgtgggagattggcaagatcattggtgggatgtggcgagacctaaccgatgaggagaagcaagagtacttgaacgaatatgaagccgaaaagattgagtacaacgaatcaatgaagacttaccacaactctcctgcttatcttgcctacatcaatgccaaaagccgggctgaagctgccctcgaggaggaaagccgccagaggcagtcgcgcatggacaagggggagccgtacatgagcatccagccggccgaggatccggacgattatgacgatggtttctccatgaagcacagcgccgctgcccgtttccagaggaaccaccggctcatcagtgaaattctcagcgagagcgtggtgcccgacgtccgctccgtggtcacgaccgctcgaatgcaggttctgaaaagacaagttcagtctctcatggtgcaccagcggaagttggaggcagaattgttacagatagaggatcgccaccaggataagaagaggaaattcttagaaagcacggagtcctttaacaatgagctgaagcggctgtgtactttaaaggtggaggtggatatggataagattgcggcagagatagcccaggcagaagagcaggcaaggaagcgccaggaggagcgggaaaaggaggccgcagaacaagcagagcgcagtcagaacgcagcagccgtggcggcagcagcagcggcggcggcagcagctgtggcagctgtggcggctgctgaggaagagcaagagcaagaggtggcaaaaccagaagaaaagagtgaagaggaggaggcccctatggagacagaagacaccccatccctgcccccagcagaggaaaccagcgagagccaacaaaatggcgaagaggggacctccacccccgacgacaaggagagcgggcaggaggcggtggacagcaccctagatgaaggtacaagcgacagcaacactgggtcggagagcaacagcggcaccgtggaggaacccaccacagactctgtagcggaagagaccgaccgcaagaactgaacactccccattcacctacatctgttttgttgtgttgtaatctgtgtctgcatggggggcagtggggaaacgctttcctaaatgtattcggctagcgttggggggggacacacacgggcttaacctgggcccctcggcttttattcactccccacggcaaaattaggagtcccagagagaggtttccttcagccctatggggggtggggcatatggtattacccagtcaagcagttgccagcgctgcagatcaacttgggagctggataggtcggagaaatagaaaattaacttttttttttaatacttttacattttgtagcaaatgaattccaaataaatgattccatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaaa
Translation: MSKRPSYAPPPAPAPTTQMPSTPGFVGYNPYSHLAYNNYRLGGNAGSNSRVTASSGITIPKPPKPPDKPLMPYMRYSRKVWDQVKASNPDLKLWEIGKIIGGMWRDLTDEEKQEYLNEYEAEKIEYNESMKTYHNSPAYLAYINAKSRAEAALEEESRQRQSRMDKGEPYMSIQPAEDPDDYDDGFSMKHSAAARFQRNHRLISEILSESVVPDVRSVVTTARMQVLKRQVQSLMVHQRKLEAELLQIEDRHQDKKRKFLESTESFNNELKRLCTLKVEVDMDKIAAEIAQAEEQARKRQEEREKEAAEQAERSQNAAAVAAAAAAAAAAVAAVAAAEEEQEQEVAKPEEKSEEEEAPMETEDTPSLPPAEETSESQQNGEEGTSTPDDKESGQEAVDSTLDEGTSDSNTGSESNSGTVEEPTTDSVAEETDRKN
Donor tissue: tailbud