ORFeome > smg7 – XORFeome 2.0

smg7 – XORFeome 2.0

General Information

Species: Xenopus tropicalis Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans), mRNA (cDNA clone MGC:76113 IMAGE:5308797), complete cds
Gene Symbol: smg7
Gene ID: 394870
ORF gb_acc:
ORF ID: 10041

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063908

Library Location

Plate ID: GDExt11001
Well Location: H08

EST Sequences

Clone: MGC:76113 IMAGE:5308797
Trimmed Sequence: ATGAGCCTGCTGTGTGCGCAGTATCTCAGGCAGGCTGAAGTCCTGAAAGCAGATATGACAGAATCTAAGCCTGGCACAGCAGAGGTGTGGACTTCCCGTCAGGCTCTACAAGATTTGTACCAGAAGATGCTGGTGACAGACCTTGAGTATGCACTGGACAAGAAGGTGGAACAGGATCTCTGGAATCATGCCTTCAAAAATCAGATAACAACGTTGCAAGGGCAAGCCAAGAACCGAACTAATCCAAATCGCAGTGAGGTACAGGCCAATTTGTCACTGTTCCTTGAGGCAGCTAGTGGCTTCTATACACAGCTTTTGCAGGAGCTTTGCACTGTGTTTAATGTGGATCTGCCATGTCGTGTGAAGTCCTCCCAGCTGGGCATTATAAGCAATAAGCAGATGCACTCTGGGACAGTTGTGAAGCCTCAGTCCAGTTCCTGCGCCTATATCTGTCAGCATTGCTTGGTTCATCTTGGAGACATTGCTCGCTATAGGAACCAGACAAGCCAGGCTGAATCCTATTATAGACATGCTGCTCAACTTGTCCCTTCCAATGGTCAGCCATATAATCAGCTGGCTATTCTTGCCTCTTCAAAAGGGGACCATTTGACCACTATTTTCTACTACTGCCGCAGCATCGCTGTCAAGTTTCCTTTTCCAGCAGCCTCCACCAATTTGCAGAAGGCCCTTTCCAAAGCCTTGGAGAGTCGCGAAGAGGTGAAGAATCGCTGGGGAGTATCAGACTTTATAAAAGCCTTTATAAAGTTCCATGGACATGTGTACTTAACAAAAAGTTTAGAGAAAGTAAGCACTCTGCGGGAACAGCTGGAAGAACAATTCAAGAACTTACTTTTTCAGAAAGCGCTTAACTCCCAGCAGCTGGTTCATATCACAGTGATAAACCTGTTTCAGCTACACCATCTGCGAAGCTTTGGCACTGAGGCAGACCAACAGAGTTTTAGCCCTGAAGAGGAGCTATGCTGGTCACAACTCTTGGCTCTCTTTATGTCGTTCTTGGGCATCCTCTGCCGGTTTCCCTTAAAGACCCATCACTGTGAGGAAACCTCCTGTGCCAACCCACTACCCGCTATCAAGGTATCATTAGACTGGATGAAGCTGCGCCCCAGTGTCTTCCAAGAGAACACCGTTGAGGAAAAAAAATATGTATGGCCATGGCTCATTTCTCTTCTGAACAGTTTCCATGTGCTTGATGAAGATGTCTCTAGTGCTAACATGCTTCCTCTCCCAGAGGAGTTTGAGCTGCAAGGATTCTTGGCACTTCGACCTGCTTTTAGAAACCTAGATTTCTCTAGAGGACACCAAGCCATCACTGGAGTTAGAGATGCCCAGCACCGGCAGCTAAGACCGCTACGACTTGCGGCTGTTGGAAAATGGATCTCTGAGAATCAGCCTCAGTTGATTCAGTATCGTACTGTTGAGGGTGAGCTATTGTTCTTTACTGACATACCTGAGCTTTTGACTGAAGACATTGATGAGACAGAGGACAGATCTTCCCCACAAGAGTTCAACCAGACAGACACTCATAAAGCTGAAGGCAGCCCTGGTTTAAAATCTGTATTATCCACTGGCCGAAGCCTGAGCTGTGACACAAACGAAAAGCCAGTGGTGACTTTTAAAGAGAACATAAAGCCACAAGAGTTAAACCGGGATGTACCATCACGCAGCTACACCAGATCAGGAAATGTTGCCAAGGATCAGAGAGACTATAACAAAAGTTTAAATAATGCTGTCAACAAAAAGGACAATAATAATAAAAGAAAGAATGAACTTAAGAAAATGTGTGTTGAGAAGACTGCTGAACCCGGGAAGCAAAGCATTGCAGTTCAGGTGAAATCTCAAACAGAGTTGAGAAAAACTCCAGTCTCTGAAGCCAGAAAAACAGCAGTGACTCCAACATCCAGTCCAAGCAGTAGCACACAGTTCATCCCTATACATCATCCTGGTGCTTTTCCCCCTCTACCCAGCCGACCAGGTTTTCCCCCACCTGCATATGTTATACCACCACCTGTGGCGTTTTCCATGAGCTCTGGCTATTCCTTTCCTGCTGGCGTTAATGTCCCAGGGTCTTTCCTGCAGCCTTCATCTCATTCACCATCTGGAAACCAGGGTCCTCCTGGGAAACAGTCCCACATTCCTTACAGTCAACAGCGCCCCTCTGGTCCAGTGACTCCTAACCAGGGTAATCTTGGCAACCAGATAACTGGCCAGATCCAACCACAGGCCCCATCCAATTCACCGACCCAGTCCAGTAGTCAGACTGCAGCACAACTACAGATCCAAGCACTTGCTCAGCAGCAGTCTCCAACTAAACCTATACAATCCATTCCCAAGCATCACACATCTCTCCAGCAGTACCAACAGGCAGAAACATCAAAACAGGTCTGGAGTACTTCTCAGGTTCCCAACGCATTGGGAAAGATGGTACCCATGAAACAATCGTATTATATGGATGGCCGTTTGCCAACAGAACCTGTAAATATGCTGGAGCAGTGTCTACAGCAGCAGCAGCCTCTGGAGAATAAGATGACCTCTTTTCCCATGGAAGCCTATGGCCAGAGCCCTTCTGATGTTAAGATGCCAGAATTCTACTGGAGTGAACCACCATCCTACAACTTAAATGACAACAGGGCTCTCTTGGCACAGCAATCTGTAAATAACCAAAGGAGCAAACGCCAGCCCACAGGCTACCGATCTGCCCAAGAGCCAATGACTAGAATGCCGTTTGAGTCTCTCCTGGAAAAGCCATCTGAACTGATATCCCAGCCCCCTTCTTTCCTCTCACTCTCTGGATTTTCACTAAGCCAGGAACGGTTCCCGAATAACAGCATGTTTAATGAGGTGTATGGAAAATCCACCTGCACGAGCATAAAGCCCGAGGCATGCCAAGTCATGGGACAACAGGAGACCTCCCTGTACTCTCTTTTTGAGGGTAAACCATGGTCTCCATCACTTCCAGCAAGCTCAGATCATTCTACGCCAGCCAGCCAGTCACCTCATTCTTCAAATCCAAGCAGCCTACCCAGCTCTCCTCCCACCCACAATCATACCTCGCAGCCCTTCTCTAACTTTGGTCCTATCGGCACTCCAGATAACCGAGATCGTCGGGGAACTGACCGCTGGAAGGCTGAAAAGCCAGTTTCAGCAATGGGTAGCTTTGGGCTGGACTACTTATCTGTGACTCCATCTTCTGAGAATAGCTGGCGCCAGGCTAATAATTCAAGTAGTGCTAATGCTTGGGCTGCTCAAGGTAATGCCCGAGAGGACTCTTCAGCTGCTCTTATGGAAAGTTTAAAGTCCATTTGGTCAACCACAATGATGCATCCTGGACCTTCTGCCTTGGAACAGCTTCTGATGCAGCAGAAGGAGAAGCAGCAGCGAGGGCAGGGATCACTGAACCCTCCGCACTGA
Full Trace Sequence: gattattgggactctccggggggttggttgtcagggggattgggggggttacaggcccggtgccccaagctcttaggtggtgggggcaccggtgaacatggctgttccacgaccgcttcgacactgagcgttgtagctagaccgacacagaaagcccggaggaggatgagcctgctgtgtgcgcagtatctcaggcaggctgaagtcctgaaagcagatatgacagaatctaagcctggcacagcagaggtgtggacttcccgtcaggctctacaagatttgtaccagaagatgctggtgacagaccttgagtatgcactggacaagaaggtggaacaggatctctggaatcatgccttcaaaaatcagataacaacgttgcaagggcaagccaagaaccgaactaatccaaatcgcagtgaggtacaggccaatttgtcactgttccttgaggcagctagtggcttctatacacagcttttgcaggagctttgcactgtgtttaatgtggatctgccatgtcgtgtgaagtcctcccagctgggcattataagcaataagcagatgcactctgggacagttgtgaagcctcagtccagttcctgcgcctatatctgtcagcattgcttggttcatcttggagacattgctcgctataggaaccagacaagccaggctgaatcctattatagacatgctgctcaacttgtcccttccaatggtcagccatataatcagctggctattcttgcctcttcaaaaggggaccatttgaccactattttctactactgccgcagcatcgctgtcaagtttccttttccagcagcctccaccaatttgcagaaggccctttccaaagccttggagagtcgcgaagaggtgaagaatcgctggggagtatcagactttataaaagcctttataaagttccatggacatgtgtacttaacaaaaagtttagagaaagtaagcactctgcgggaacagctggaagaacaattcaagaacttactttttcagaaagcgcttaactcccagcagctggttcatatcacagtgataaacctgtttcagctacaccatctgcgaagctttggcactgaggcagaccaacagagttttagccctgaagaggagctatgctggtcacaactcttggctctctttatgtcgttcttgggcatcctctgccggtttcccttaaagacccatcactgtgaggaaacctcctgtgccaacccactacccgctatcaaggtatcattagactggatgaagctgcgccccagtgtcttccaagagaacaccgttgaggaaaaaaaatatgtatggccatggctcatttctcttctgaacagtttccatgtgcttgatgaagatgtctctagtgctaacatgcttcctctcccagaggagtttgagctgcaaggattcttggcacttcgacctgcttttagaaacctagatttctctagaggacaccaagccatcactggagttagagatgcccagcaccggcagctaagaccgctacgacttgcggctgttggaaaatggatctctgagaatcagcctcagttgattcagtatcgtactgttgagggtgagctattgttctttactgacatacctgagcttttgactgaagacattgatgagacagaggacagatcttccccacaagagttcaaccagacagacactcataaagctgaaggcagccctggtttaaaatctgtattatccactggccgaagcctgagctgtgacacaaacgaaaagccagtggtgacttttaaagagaacataaagccacaagagttaaaccgggatgtaccatcacgcagctacaccagatcaggaaatgttgccaaggatcagagagactataacaaaagtttaaataatgctgtcaacaaaaaggacaataataataaaagaaagaatgaacttaagaaaatgtgtgttgagaagactgctgaacccgggaagcaaagcattgcagttcaggtgaaatctcaaacagagttgagaaaaactccagtctctgaagccagaaaaacagcagtgactccaacatccagtccaagcagtagcacacagttcatccctatacatcatcctggtgcttttccccctctacccagccgaccaggttttcccccacctgcatatgttataccaccacctgtggcgttttccatgagctctggctattcctttcctgctggcgttaatgtcccagggtctttcctgcagccttcatctcattcaccatctggaaaccagggtcctcctgggaaacagtcccacattccttacagtcaacagcgcccctctggtccagtgactcctaaccagggtaatcttggcaaccagataactggccagatccaaccacaggccccatccaattcaccgacccagtccagtagtcagactgcagcacaactacagatccaagcacttgctcagcagcagtctccaactaaacctatacaatccattcccaagcatcacacatctctccagcagtaccaacaggcagaaacatcaaaacaggtctggagtacttctcaggttcccaacgcattgggaaagatggtacccatgaaacaatcgtattatatggatggccgtttgccaacagaacctgtaaatatgctggagcagtgtctacagcagcagcagcctctggagaataagatgacctcttttcccatggaagcctatggccagagcccttctgatgttaagatgccagaattctactggagtgaaccaccatcctacaacttaaatgacaacagggctctcttggcacagcaatctgtaaataaccaaaggagcaaacgccagcccacaggctaccgatctgcccaagagccaatgactagaatgccgtttgagtctctcctggaaaagccatctgaactgatatcccagcccccttctttcctctcactctctggattttcactaagccaggaacggttcccgaataacagcatgtttaatgaggtgtatggaaaatccacctgcacgagcataaagcccgaggcatgccaagtcatgggacaacaggagacctccctgtactctctttttgagggtaaaccatggtctccatcacttccagcaagctcagatcattctacgccagccagccagtcacctcattcttcaaatccaagcagcctacccagctctcctcccacccacaatcatacctcgcagcccttctctaactttggtcctatcggcactccagataaccgagatcgtcggggaactgaccgctggaaggctgaaaagccagtttcagcaatgggtagctttgggctggactacttatctgtgactccatcttctgagaatagctggcgccaggctaataattcaagtagtgctaatgcttgggctgctcaaggtaatgcccgagaggactcttcagctgctcttatggaaagtttaaagtccatttggtcaaccacaatgatgcatcctggaccttctgccttggaacagcttctgatgcagcagaaggagaagcagcagcgagggcagggatcactgaaccctccgcactgagaaagagagggagatgaacccagcaacaaaaaaaaaaaaaaaaa
Translation: MSLLCAQYLRQAEVLKADMTESKPGTAEVWTSRQALQDLYQKMLVTDLEYALDKKVEQDLWNHAFKNQITTLQGQAKNRTNPNRSEVQANLSLFLEAASGFYTQLLQELCTVFNVDLPCRVKSSQLGIISNKQMHSGTVVKPQSSSCAYICQHCLVHLGDIARYRNQTSQAESYYRHAAQLVPSNGQPYNQLAILASSKGDHLTTIFYYCRSIAVKFPFPAASTNLQKALSKALESREEVKNRWGVSDFIKAFIKFHGHVYLTKSLEKVSTLREQLEEQFKNLLFQKALNSQQLVHITVINLFQLHHLRSFGTEADQQSFSPEEELCWSQLLALFMSFLGILCRFPLKTHHCEETSCANPLPAIKVSLDWMKLRPSVFQENTVEEKKYVWPWLISLLNSFHVLDEDVSSANMLPLPEEFELQGFLALRPAFRNLDFSRGHQAITGVRDAQHRQLRPLRLAAVGKWISENQPQLIQYRTVEGELLFFTDIPELLTEDIDETEDRSSPQEFNQTDTHKAEGSPGLKSVLSTGRSLSCDTNEKPVVTFKENIKPQELNRDVPSRSYTRSGNVAKDQRDYNKSLNNAVNKKDNNNKRKNELKKMCVEKTAEPGKQSIAVQVKSQTELRKTPVSEARKTAVTPTSSPSSSTQFIPIHHPGAFPPLPSRPGFPPPAYVIPPPVAFSMSSGYSFPAGVNVPGSFLQPSSHSPSGNQGPPGKQSHIPYSQQRPSGPVTPNQGNLGNQITGQIQPQAPSNSPTQSSSQTAAQLQIQALAQQQSPTKPIQSIPKHHTSLQQYQQAETSKQVWSTSQVPNALGKMVPMKQSYYMDGRLPTEPVNMLEQCLQQQQPLENKMTSFPMEAYGQSPSDVKMPEFYWSEPPSYNLNDNRALLAQQSVNNQRSKRQPTGYRSAQEPMTRMPFESLLEKPSELISQPPSFLSLSGFSLSQERFPNNSMFNEVYGKSTCTSIKPEACQVMGQQETSLYSLFEGKPWSPSLPASSDHSTPASQSPHSSNPSSLPSSPPTHNHTSQPFSNFGPIGTPDNRDRRGTDRWKAEKPVSAMGSFGLDYLSVTPSSENSWRQANNSSSANAWAAQGNAREDSSAALMESLKSIWSTTMMHPGPSALEQLLMQQKEKQQRGQGSLNPPH
Donor tissue: gastrula