ORFeome > snap29 – XORFeome 2.0

snap29 – XORFeome 2.0

General Information

Species: Xenopus tropicalis synaptosomal-associated protein, 29kDa, mRNA (cDNA clone MGC:75781 IMAGE:5381937), complete cds
Gene Symbol: snap29
Gene ID: 394585
ORF gb_acc:
ORF ID: 10303

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061308

Library Location

Plate ID: GDExt11003
Well Location: F11

EST Sequences

Clone: MGC:75781 IMAGE:5381937
Trimmed Sequence: ATGTCCAGAAGCTACAATCCCTTTGATGAAGATGAGGACGATGACTTTAAACCAGTGAAGTGGAACGATGCAGCTGACCCTTATGAAGACCCAGTAGAAAAAAGAAAGAGGGAGGCAGCTGACAAGCAGAGGAGTTTGCAGCAAGAGGTGACAAGGAGGGCAGAGTCCATGGTTGACAGCAGCAACAGGTCATTGTCACTAGTGTATGATTCTGAGAAGATTGGGGTAGACACTGCAGAAGAACTTGTCCGACAAGGAGAGGCTTTGAAGCGGACAGAGAGGATGGTCGATAAGATGGAACAGGACATGAAAACTAGCCAGAAACACATTAACAGTATAAAGAGTATGTTTAGTGGATTCACAAACTACTTTAGGTCAAAACCAGCTGAAACACCTCCTGAAAATGGAGCATCCGAATACAAATCCAGTACAAAATTAGAGGAAGCCTTGTCAAGCAGCAAAGCGCAGGAAGATAAGTATCAAGCTACACATCCCAACCTGCTGAAAAGAGAAACTTTAGAGTCAAGCAATAATATGGGAGCATCCAGCTCTGGATATCAACACAAGAACCAGGTGCTAAGAAATTATCACCAGAAAGTCGACTCTAATTTAGATGACATGTCTTTAGGTTTGGGTCGCCTGAAAAACCTTGCACTAGGACTTCAGACAGAAATCGATGACCAGGATGAGATGCTTGGGCGCCTAACTGGCAAAGTAGATAAGATGGACTTAAACATCAAGACTACAGACAAGCGGATTCGCGAAGAGCTATAA
Full Trace Sequence: gaagtcagaagtgatttctgcaaaatcatttaaattcattaaaatgaaagaacacaaaatagttgaatgcataagtgttcacccaatcctgtcatgtcagtggcgtaacagaagcatgccgtaacagtggagagaagccatagcataccacagaagaatagaacctcattctcatcatgtccagaagctacaatccctttgatgaagatgaggacgatgactttaaaccagtgaagtggaacgatgcagctgacccttatgaagacccagtagaaaaaagaaagagggaggcagctgacaagcagaggagtttgcagcaagaggtgacaaggagggcagagtccatggttgacagcagcaacaggtcattgtcactagtgtatgattctgagaagattggggtagacactgcagaagaacttgtccgacaaggagaggctttgaagcggacagagaggatggtcgataagatggaacaggacatgaaaactagccagaaacacattaacagtataaagagtatgtttagtggattcacaaactactttaggtcaaaaccagctgaaacacctcctgaaaatggagcatccgaatacaaatccagtacaaaattagaggaagccttgtcaagcagcaaagcgcaggaagataagtatcaagctacacatcccaacctgctgaaaagagaaactttagagtcaagcaataatatgggagcatccagctctggatatcaacacaagaaccaggtgctaagaaattatcaccagaaagtcgactctaatttagatgacatgtctttaggtttgggtcgcctgaaaaaccttgcactaggacttcagacagaaatcgatgaccaggatgagatgcttgggcgcctaactggcaaagtagataagatggacttaaacatcaagactacagacaagcggattcgcgaagagctataaaagacaaatttcagacttgaccaagaccgactcttgagttttattcttgtggtttttataatgttatgcagtttttttttgtttgtttttttttatactgggacataaatatcccacacatccctatctgaatcttatatcttctgtataactatacattacattcgttagcattaaatgtagatgatgttttgcagtattattactaatatagatccttattaagatataaaaatgaattgtcttactattggaattgtattgtagtgattggcagtttgctatagctctggatctgaataaagtatttgagttcatttgctaggtattaccttactgctatatgacagaatagacatatgaacatgcctttattaaaactgcaatattttacacatgctcgtaacatagggtttaatgggccctgccatatgccactttcttattacccttattattttaatctagtgttctgaaactttgtgtataaatatgtttataaatttatgtgacactcctgtaaaccatactgtgaatattttatcagtttacttgttaagttaaaaaaaaaagcctaataatcttgcctgttattattttaactaacttgtttaatatattatttgctttttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSRSYNPFDEDEDDDFKPVKWNDAADPYEDPVEKRKREAADKQRSLQQEVTRRAESMVDSSNRSLSLVYDSEKIGVDTAEELVRQGEALKRTERMVDKMEQDMKTSQKHINSIKSMFSGFTNYFRSKPAETPPENGASEYKSSTKLEEALSSSKAQEDKYQATHPNLLKRETLESSNNMGASSSGYQHKNQVLRNYHQKVDSNLDDMSLGLGRLKNLALGLQTEIDDQDEMLGRLTGKVDKMDLNIKTTDKRIREEL
Donor tissue: tadpole