ORFeome > snd1 – XORFeome 2.0

snd1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis staphylococcal nuclease domain containing 1, mRNA (cDNA clone MGC:76153 IMAGE:5335308), complete cds
Gene Symbol: snd1
Gene ID: 394791
ORF gb_acc:
ORF ID: 9982

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063211

Library Location

Plate ID: GDExt11001
Well Location: C09

EST Sequences

Clone: MGC:76153 IMAGE:5335308
Trimmed Sequence: ATGGTGCTCTCAGGATGTGCTATAATTGTACGGGGCCAACCACGTGGAGGGCCACCTCCAGAGAGGCAGATCAATCTCAGTAATATCCGTACAGGAGCTCTTGCCCGCCGGGCTGCTGCATCTCAGCAAGATGCAAAGGACACCCCCGATGAGCCTTGGGCTTTTCCTGCCCGGGAGTTCCTGAGGAAAAAGCTGATTGGAAAAGAGGTTTGCTTTACTGTGGATTTCAAGTCTTCTCAGGGGAGAGAATATGGCATGGTTTACCTGGGAAAAGATACCAGTGGAGAGAACATTGCTGAGTCACTTGTTGCGGAAGGACTGGCCTCACGACGTGAAGGAGTGCGTGCAAACACTCCTGAACAAAGCCGTCTGGCAGAAGTTGAAGAGCAAGCAAGATCAGCAAAGAAGGGAGTTTGGAGTGAAGGTACAGGATCTCAAACTGTACGGGACCTCAAATACACAATAGAAAATCCAAGACATTTTGTGGATTCCATGCACCAGAAGCCTGTTAATGCCATAATTGAGCATGTGAGAGATGGCAGCGTGGTTCGAGCTCTGCTGCTTCCTGATTGCTATCTTGTAACAGTCATGCTGTCTGGAATAAAGTGCCCAACCTTCAAACGGGAAGCAGATGGAACAGAGACTCCAGAGCCCTTTGCAGCAGAAGCAAAGTTTTTCACTGAGTCCCGATTGCTTCAGAGAGATGTGCAAATAATCTTGGAGAGCTGCCACAACCAAAATATCTTGGGCACCATCCTACACCCTAATGGAAACATCACAGAACTTCTGCTGAAGGAAGGTTTTGCCCGTTGTGTTGACTGGTGTATAGCTGTGTATACCCAAGGATCTGAGAAGCTGCGGGCTGCTGAACGCTTTGCCAAGGAGCACAAGACACGAATTTGGAGAGATTATGTTGCACCCACAGCTAATCTCGATCAGAAGGACAAGCAGTTTGTTGCAAAGGTGGTACAGATTCTAAATGCGGATGCCATGGTGGTGAAGCTGAATTCAGGAGACTACAAAACCATTCATCTCTCCAGTATCAGACCACCAAGGCTTGAAGGAGAAGGAGCACAGGATAAGAACAAGAAGCTTCGTCCTCTTTATGACATCCCATACATGTTTGAGGCAAGGGAGTTTCTCCGGAAGAAGCTTATTGGGAAAAAGGTTAATGTAAACGTAGATTATATCCGATCAGCAAGTGCAGCAACTGAAACAGTTCCAGCATTTCCTGAGCGCACATGTGCCACAGTGACCATTGGAGGAATAAACATTGCAGAAGCTCTTGTAAGCAAAGGCCTTGCCACCGTGATCCGTTACAGACAGGATGATGACCAGAGATCCTCTCATTATGATGAATTGCTAGCAGCAGAAGCCCGAGCTATCAAGAATGCCAAAGGCCTACACAGTAAAAAGGAGGTTCCCATCCACAGAGTGGCAGACATTTCTGGGGACACTCAAAAGGCAAAACAGTTCCTGCCTTTCCTGCAGAGAGCTGGTCGCTCTGAAGCAGTTGTAGAGTATGTTTTCAGTGGGTCCAGACTCAAGCTTTATATGCCAAAGGAAACCTGCCTTATCACCTTCCTCCTGGCTGGCATTGAGTGCCCACGAGGTTCAAGGAACATGCCTAGTGGAGTACAAGAAGGTGAGCCATTCAGTGAAGAGGCAACACTATTCACCAAGGAGTTGGTGCTTCAGAGAGAGGTGGAAGTAGAAGTGGAAGCAATGGATAAAGCTGGGAACTTTATTGGATGGCTTCATGTTGATGGCGTCAATATCTCTGTCGCTCTGGTAGAACATGCACTGTCTAAGGTCCACTTCACAGCAGAGCGCAGTAACTACTATAAGACACTCTTGGCAGCAGAAGAGGGACCCAAACAGAGAAAGGAAAAGGTCTGGTCCAAGTTTGAGGAGCAACCAGTGGAAGAAGTAGTGACTGTAGTGGAAGAGAAAGAAAGAAACGCTAATTACAAGCCTGTTCTTGTGACCGAGATCACAGATGAATTGCACTTCTACATCCAGGATGTTGAGACTGGGACACAACTAGAAAAGCTGATGGAAAGCATGAGAAGTGAAATTGCCAGCAACCCCCCACTTGAAGGATCTTTCTCACCACGCCGGGGAGATTACTGCATTGCCAAATATATGGATGGGGAATGGTATCGAGCACGGGTAGAGAAGGTGGAATCTGTTGCCAAAGTCCATGTTTTCTATATTGATTATGGGAATAGAGAAGTTCTGCCTTCCACCCGGCTGGGTCCTCTCCCACAGTCTTTCAGTACACGCACCCTTCCAGCACAGGCTATAGAGTATTGCTTTGCTTTCATCCAAGTGCCCGCTGATGAAGATGCTCGGGCTGATGTGGTGGACAACGTTGTTCGTGACATTCAGAATACACAGTGCTTGCTGAATGTGGAGCACAGTGGAGCTGGTTGCCCACATGTTACGCTGCAGTTTGCAGACTCCAAGGAAGATGTGGGCTTAGGCTTGGTGAAAGAAGGTCTTGTGATGGTGGAAGTTCGCAAGGAAAAGCAGTTTCAGAAAGTGATTGCGGAATACGTGTCTGCTCAAGAGTCTGCCAAGGCTGCTCGGTTGAATCTGTGGCGTTACGGAGATTTCCGAGCAGATGATGCGGATGAATTTGGCTATAGCCGTTAA
Full Trace Sequence: cggcagaataatggcatcttctggggctcaaactggacccgtggcacccgcactgcagagggggatcgtcaagatggtgctctcaggatgtgctataattgtacggggccaaccacgtggagggccacctccagagaggcagatcaatctcagtaatatccgtacaggagctcttgcccgccgggctgctgcatctcagcaagatgcaaaggacacccccgatgagccttgggcttttcctgcccgggagttcctgaggaaaaagctgattggaaaagaggtttgctttactgtggatttcaagtcttctcaggggagagaatatggcatggtttacctgggaaaagataccagtggagagaacattgctgagtcacttgttgcggaaggactggcctcacgacgtgaaggagtgcgtgcaaacactcctgaacaaagccgtctggcagaagttgaagagcaagcaagatcagcaaagaagggagtttggagtgaaggtacaggatctcaaactgtacgggacctcaaatacacaatagaaaatccaagacattttgtggattccatgcaccagaagcctgttaatgccataattgagcatgtgagagatggcagcgtggttcgagctctgctgcttcctgattgctatcttgtaacagtcatgctgtctggaataaagtgcccaaccttcaaacgggaagcagatggaacagagactccagagccctttgcagcagaagcaaagtttttcactgagtcccgattgcttcagagagatgtgcaaataatcttggagagctgccacaaccaaaatatcttgggcaccatcctacaccctaatggaaacatcacagaacttctgctgaaggaaggttttgcccgttgtgttgactggtgtatagctgtgtatacccaaggatctgagaagctgcgggctgctgaacgctttgccaaggagcacaagacacgaatttggagagattatgttgcacccacagctaatctcgatcagaaggacaagcagtttgttgcaaaggtggtacagattctaaatgcggatgccatggtggtgaagctgaattcaggagactacaaaaccattcatctctccagtatcagaccaccaaggcttgaaggagaaggagcacaggataagaacaagaagcttcgtcctctttatgacatcccatacatgtttgaggcaagggagtttctccggaagaagcttattgggaaaaaggttaatgtaaacgtagattatatccgatcagcaagtgcagcaactgaaacagttccagcatttcctgagcgcacatgtgccacagtgaccattggaggaataaacattgcagaagctcttgtaagcaaaggccttgccaccgtgatccgttacagacaggatgatgaccagagatcctctcattatgatgaattgctagcagcagaagcccgagctatcaagaatgccaaaggcctacacagtaaaaaggaggttcccatccacagagtggcagacatttctggggacactcaaaaggcaaaacagttcctgcctttcctgcagagagctggtcgctctgaagcagttgtagagtatgttttcagtgggtccagactcaagctttatatgccaaaggaaacctgccttatcaccttcctcctggctggcattgagtgcccacgaggttcaaggaacatgcctagtggagtacaagaaggtgagccattcagtgaagaggcaacactattcaccaaggagttggtgcttcagagagaggtggaagtagaagtggaagcaatggataaagctgggaactttattggatggcttcatgttgatggcgtcaatatctctgtcgctctggtagaacatgcactgtctaaggtccacttcacagcagagcgcagtaactactataagacactcttggcagcagaagagggacccaaacagagaaaggaaaaggtctggtccaagtttgaggagcaaccagtggaagaagtagtgactgtagtggaagagaaagaaagaaacgctaattacaagcctgttcttgtgaccgagatcacagatgaattgcacttctacatccaggatgttgagactgggacacaactagaaaagctgatggaaagcatgagaagtgaaattgccagcaaccccccacttgaaggatctttctcaccacgccggggagattactgcattgccaaatatatggatggggaatggtatcgagcacgggtagagaaggtggaatctgttgccaaagtccatgttttctatattgattatgggaatagagaagttctgccttccacccggctgggtcctctcccacagtctttcagtacacgcacccttccagcacaggctatagagtattgctttgctttcatccaagtgcccgctgatgaagatgctcgggctgatgtggtggacaacgttgttcgtgacattcagaatacacagtgcttgctgaatgtggagcacagtggagctggttgcccacatgttacgctgcagtttgcagactccaaggaagatgtgggcttaggcttggtgaaagaaggtcttgtgatggtggaagttcgcaaggaaaagcagtttcagaaagtgattgcggaatacgtgtctgctcaagagtctgccaaggctgctcggttgaatctgtggcgttacggagatttccgagcagatgatgcggatgaatttggctatagccgttaagggacgccattccaaagatgagacccagccatcttacgcagccattttgctcttgttgcctgcagaccctccttaacctacccctgtcctgcctgagcataaaaggtaggcatggggaggtttttatggaactcgcagttgacaccctgcaggctgcacacagggggtaatcctggacaatataaatacaactattttaacatttacgtctttcccacttccatctgtctgcacccagaaaaaaatgtattctacaattctaaaggcagaagcatacctatgggctgaaagtagttttgtatgagttacgtgtgattcagtcctgcgtcctgaaattgtccttttaacggttacttgtaatgattttatctgtcttattattatcaaatatcatctggaattttcctcccttttgtccagggtcatatgtttttgtcttgtgtatttaatggctcaataaagtacagcgttctgattccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MVLSGCAIIVRGQPRGGPPPERQINLSNIRTGALARRAAASQQDAKDTPDEPWAFPAREFLRKKLIGKEVCFTVDFKSSQGREYGMVYLGKDTSGENIAESLVAEGLASRREGVRANTPEQSRLAEVEEQARSAKKGVWSEGTGSQTVRDLKYTIENPRHFVDSMHQKPVNAIIEHVRDGSVVRALLLPDCYLVTVMLSGIKCPTFKREADGTETPEPFAAEAKFFTESRLLQRDVQIILESCHNQNILGTILHPNGNITELLLKEGFARCVDWCIAVYTQGSEKLRAAERFAKEHKTRIWRDYVAPTANLDQKDKQFVAKVVQILNADAMVVKLNSGDYKTIHLSSIRPPRLEGEGAQDKNKKLRPLYDIPYMFEAREFLRKKLIGKKVNVNVDYIRSASAATETVPAFPERTCATVTIGGINIAEALVSKGLATVIRYRQDDDQRSSHYDELLAAEARAIKNAKGLHSKKEVPIHRVADISGDTQKAKQFLPFLQRAGRSEAVVEYVFSGSRLKLYMPKETCLITFLLAGIECPRGSRNMPSGVQEGEPFSEEATLFTKELVLQREVEVEVEAMDKAGNFIGWLHVDGVNISVALVEHALSKVHFTAERSNYYKTLLAAEEGPKQRKEKVWSKFEEQPVEEVVTVVEEKERNANYKPVLVTEITDELHFYIQDVETGTQLEKLMESMRSEIASNPPLEGSFSPRRGDYCIAKYMDGEWYRARVEKVESVAKVHVFYIDYGNREVLPSTRLGPLPQSFSTRTLPAQAIEYCFAFIQVPADEDARADVVDNVVRDIQNTQCLLNVEHSGAGCPHVTLQFADSKEDVGLGLVKEGLVMVEVRKEKQFQKVIAEYVSAQESAKAARLNLWRYGDFRADDADEFGYSR
Donor tissue: tailbud