ORFeome > srp54 – XORFeome 2.0

srp54 – XORFeome 2.0

General Information

Species: Xenopus tropicalis signal recognition particle 54, mRNA (cDNA clone MGC:75926 IMAGE:5383770), complete cds
Gene Symbol: srp54
Gene ID: 394574
ORF gb_acc: MG133005
ORF ID: 10392

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061368

Library Location

Plate ID: GDExt11005
Well Location: B02

EST Sequences

Clone: MGC:75926 IMAGE:5383770
Trimmed Sequence: ATGGTGTTGGCAGACCTAGGACGGAAGATTACTTCAGCACTGCGCTCACTGAGCAATGCAACAATCATCAATGAAGAGGTGCTCAATGCTATGCTCAAGGAAGTATGCAAGGCTTTACTGGAAGCTGATGTGAACATAAAGCTTGTAAAGCAGCTGAGGGAAAATGTCAAGTCTGCTATTGATCTGGAGGAAATGGCATCTGGCTTGAATAAGAGGAAAATGATCCAGCATGCTGTCTTCAAAGAGCTCGTCAAGCTGGTGGATCCAGGGGTTAAAGCATGGACACCAACTAAAGGAAAACCTAATGTCATAATGTTTGTGGGTTTGCAAGGAAGTGGAAAAACCACCACTTGTACAAAGTTGGCATATTATTATCAAAGGAAAGGATGGAAAACCTGTTTGATATGTGCTGACACTTTCAGAGCTGGAGCTTTTGACCAGTTAAAACAGAATGCCACAAAAGCCAGAATACCTTTCTATGGCAGTTATACAGAAATGGATCCAGTGAACATTGCATATGAAGGGGTGGAGAAATTTAAAAATGAAAACTTTGAGATTGTCATTGTGGACACAAGTGGGCGCCACAAACAAGAAGATTCCTTGTTTGAAGAAATGTTGCAAGTGTCTAATGCAGTACAACCGGATAATATAGTCTATGTTATGGATGCTTCTATCGGACAAGCTTGTGAAGCCCAGGCTAAAGCCTTCAAAGATAAGGTGGATGTAGCATCAGTCATTGTAACCAAGCTTGATGGGCATGCAAAGGGTGGAGGAGCGCTTAGTGCGGTTGCTGCTACAAAGAGTCCCATCATTTTTATTGGAACTGGGGAGCATATTGATGACTTCGAACCATTTAAAACACAACCTTTCATTAGCAAGCTTCTTGGTATGGGTGACATTGAAGGATTGATAGATAAAGTGAACGAATTAAAACTGGATGACAATGAGGCCCTCATAGAGAAACTAAAGCATGGCCAGTTCACTCTGAGAGACATGTATGAGCAGTTTCAAAACATTATGAAAATGGGTCCATTCAGCCAGATATTGGGGATGATTCCTGGCTTTGGACAAGATTTTATGAGCAAAGGCAATGAGCAGGAATCAATGGCTCGACTAAAGAAGCTAATGACCATCATGGACAGCATGAACGATCAGGAATTGGATAACACAGATGGTGCCAAACTTTTTAGCAAGCAGCCCGGGAGGGTTCAGAGAGTGGCAAGAGGATCTGGAGTCTCTACTAGAGATGTACAAGAGCTGCTGGCACAATATACAAAATTTGCTCAAATGGTTAAAAAAATGGGAGGAATCAAAGGCCTCTTCAAAGGTGGTGATATGTCAAAAAATGTAAACCCGTCACAGATGGCCAAACTGAACCAGCAAATGGCCAAAATGATGGACCCCAGAGTTTTGCAGCACATGGGTGGCATGGCAGGACTTCAGTCAATGATGAGACAGTTCCAACAAGGAGCTGCTGGCAACATGAAGGGGATGATGGGATTCAACAACATGTAA
Full Trace Sequence: gttgagtttgtaatttcgttatatggacattgcgttgcctgagcatcgaccggtccagttggggatataaaagcatatagtgggagggctgagggacccccacattgggggcttatttctcatcaggtgttgtgtaacaaacagaagccaagatggtgttggcagacctaggacggaagattacttcagcactgcgctcactgagcaatgcaacaatcatcaatgaagaggtgctcaatgctatgctcaaggaagtatgcaaggctttactggaagctgatgtgaacataaagcttgtaaagcagctgagggaaaatgtcaagtctgctattgatctggaggaaatggcatctggcttgaataagaggaaaatgatccagcatgctgtcttcaaagagctcgtcaagctggtggatccaggggttaaagcatggacaccaactaaaggaaaacctaatgtcataatgtttgtgggtttgcaaggaagtggaaaaaccaccacttgtacaaagttggcatattattatcaaaggaaaggatggaaaacctgtttgatatgtgctgacactttcagagctggagcttttgaccagttaaaacagaatgccacaaaagccagaatacctttctatggcagttatacagaaatggatccagtgaacattgcatatgaaggggtggagaaatttaaaaatgaaaactttgagattgtcattgtggacacaagtgggcgccacaaacaagaagattccttgtttgaagaaatgttgcaagtgtctaatgcagtacaaccggataatatagtctatgttatggatgcttctatcggacaagcttgtgaagcccaggctaaagccttcaaagataaggtggatgtagcatcagtcattgtaaccaagcttgatgggcatgcaaagggtggaggagcgcttagtgcggttgctgctacaaagagtcccatcatttttattggaactggggagcatattgatgacttcgaaccatttaaaacacaacctttcattagcaagcttcttggtatgggtgacattgaaggattgatagataaagtgaacgaattaaaactggatgacaatgaggccctcatagagaaactaaagcatggccagttcactctgagagacatgtatgagcagtttcaaaacattatgaaaatgggtccattcagccagatattggggatgattcctggctttggacaagattttatgagcaaaggcaatgagcaggaatcaatggctcgactaaagaagctaatgaccatcatggacagcatgaacgatcaggaattggataacacagatggtgccaaactttttagcaagcagcccgggagggttcagagagtggcaagaggatctggagtctctactagagatgtacaagagctgctggcacaatatacaaaatttgctcaaatggttaaaaaaatgggaggaatcaaaggcctcttcaaaggtggtgatatgtcaaaaaatgtaaacccgtcacagatggccaaactgaaccagcaaatggccaaaatgatggaccccagagttttgcagcacatgggtggcatggcaggacttcagtcaatgatgagacagttccaacaaggagctgctggcaacatgaaggggatgatgggattcaacaacatgtaaagatgccctttttgcacagtggatgtttcttattactgtggcttcaaagaactggaatgctttctgggcagacaaatgtggtctctataaattctctacttccattaaaaataaaaagaaaccacccttctactgtttaactccccccaagtattccttattttcagggaactggggtgcaacaccctattttaagttattggacaattaatttagtttttatcaaaacaaagtctgttgtataaaaaaaaaaactgttaatgtttagttcaaagacaaactgtttgtatacgcttccagcactcacacctcttgctggaattcaatttgctgttaaataaatttctaaatggtcatatttcttgttccgaaatatatttaaataatcagtcctgttaaaggggcagtatacaccatacataaacctttgttcaacatgagtacaataaatagtgttgaaaataaaaaaaaaaaaaaaaaaaaaa
Translation: MVLADLGRKITSALRSLSNATIINEEVLNAMLKEVCKALLEADVNIKLVKQLRENVKSAIDLEEMASGLNKRKMIQHAVFKELVKLVDPGVKAWTPTKGKPNVIMFVGLQGSGKTTTCTKLAYYYQRKGWKTCLICADTFRAGAFDQLKQNATKARIPFYGSYTEMDPVNIAYEGVEKFKNENFEIVIVDTSGRHKQEDSLFEEMLQVSNAVQPDNIVYVMDASIGQACEAQAKAFKDKVDVASVIVTKLDGHAKGGGALSAVAATKSPIIFIGTGEHIDDFEPFKTQPFISKLLGMGDIEGLIDKVNELKLDDNEALIEKLKHGQFTLRDMYEQFQNIMKMGPFSQILGMIPGFGQDFMSKGNEQESMARLKKLMTIMDSMNDQELDNTDGAKLFSKQPGRVQRVARGSGVSTRDVQELLAQYTKFAQMVKKMGGIKGLFKGGDMSKNVNPSQMAKLNQQMAKMMDPRVLQHMGGMAGLQSMMRQFQQGAAGNMKGMMGFNNM
Donor tissue: neurula