ORFeome > srprb – XORFeome 2.0

srprb – XORFeome 2.0

General Information

Species: Xenopus tropicalis signal recognition particle receptor, B subunit, mRNA (cDNA clone MGC:75930 IMAGE:5383790), complete cds
Gene Symbol: srprb
Gene ID: 394639
ORF gb_acc: MG133002
ORF ID: 10389

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061370

Library Location

Plate ID: GDExt11004
Well Location: F11

EST Sequences

Clone: MGC:75930 IMAGE:5383790
Trimmed Sequence: ATGGAGTTCATTACGCAGGAGCTGCAGAAGCAAGACCCGACCTTGCTCTCCGTGGGGATCGCCCTAATTGTTGTCGTGCTTAGCTTTGTTCTATGGAAGATTCTGCGAGGCAGTCGGACCAGCCGCAGAGCAGTGCTGCTTATTGGAGTGTGTGACTCGGGAAAAACTCTACTGTTCAACAGGTTACTTACAGGAACATACAAGAAAACCCAAACCTCCATCACTGCCAATTGTGCTGCATATAAAGTGAAGAATGACAAGGGTTCCAGTTTGACGCTTGTTGACCTCCCTGGCCATGAAAGTTTGAGGCTTCAGTTCCTGGAGCAATATAAAGCATCAGCAAGGGCATTGCTGTTTGTAGTGGACAGTTCCGCGTTCCAGCGTGAGGTGAAGGAGGTGGCAGAGCTTTTTTACCAACTTTTGACAGATGTTGCAATACTGAAAAATGTGCCACCAATACTTATTGCGTGCAATAAGCAAGATATTTCAATGGCCAAATCTGCCAAACTTATACAGCAGCAGCTGGAGAAAGAGCTGAACACTCTTCGTGTCACCCGCTCAGCTGCCCCTAGCATCTTGGAGAGTGGAAACTCTGGCGTCACGCAGCTTGGGAAGAAAGGCAAAGACTTTGATTTTACCCAGTTGCCTATGAAGGTAAAATTCCTGGAATGCAGCACTCGGGACAGTAAAGAAGAGGACGGTGATGCCAATATCAGTAATGTTGAGGGCTGGCTGGCGAAGCTGGTTTGA
Full Trace Sequence: gcaggagtacgcatgcgctgcgcttagttactgctacgtgtgaataatggcggagcctcaggttcaacatgattctcggtggttgccggacatggagttcattacgcaggagctgcagaagcaagacccgaccttgctctccgtggggatcgccctaattgttgtcgtgcttagctttgttctatggaagattctgcgaggcagtcggaccagccgcagagcagtgctgcttattggagtgtgtgactcgggaaaaactctactgttcaacaggttacttacaggaacatacaagaaaacccaaacctccatcactgccaattgtgctgcatataaagtgaagaatgacaagggttccagtttgacgcttgttgacctccctggccatgaaagtttgaggcttcagttcctggagcaatataaagcatcagcaagggcattgctgtttgtagtggacagttccgcgttccagcgtgaggtgaaggaggtggcagagcttttttaccaacttttgacagatgttgcaatactgaaaaatgtgccaccaatacttattgcgtgcaataagcaagatatttcaatggccaaatctgccaaacttatacagcagcagctggagaaagagctgaacactcttcgtgtcacccgctcagctgcccctagcatcttggagagtggaaactctggcgtcacgcagcttgggaagaaaggcaaagactttgattttacccagttgcctatgaaggtaaaattcctggaatgcagcactcgggacagtaaagaagaggacggtgatgccaatatcagtaatgttgagggctggctggcgaagctggtttgagaaacttttcccaagttgtacaaggacacaggcgctaagatgatgaaacattgaatggatttttctgcatcttgactcgtaagggaaacccttatttggttggtgccttgttcatgactgctgcattggtgaggctgccgctttcttactatgctttagacaaaagaaacgtgcagctctgaggaaacagtgtctattttgtcagctcttgtactccatgtcacttgaacaataaccaaaatgtaatgaattccttacatgctggatttccacctcccattctgtgctgagggaatggttaatgcagagcaacctgtatttctccagcctttgtctagctacaacttccactgtaccatttacagcctttggcatggacgttaggtacatgtttagacatctggaggaccacaggttgtgttgtgccaccaaccagtggctcaggggcaacatgttgctcaccaaccccttggatcttgcgctcagtgcccccaaaccaggtagttatttttgaattcctgacttagtggcaagttttggtttaataaaaacaagatttactcccaaataaagcctcctgtaagctgatagagactgcctaatagccaatcttagcccttatttggcaccttcatgaacttttataatgctttagttgctctccaagtctttttacatttggctgttactcactagtaagaaaggctgggaacccctgctctagggacatatatttattttgaatttgaactttcaaataaatcagtattaaagtggaagttcaccttcaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MEFITQELQKQDPTLLSVGIALIVVVLSFVLWKILRGSRTSRRAVLLIGVCDSGKTLLFNRLLTGTYKKTQTSITANCAAYKVKNDKGSSLTLVDLPGHESLRLQFLEQYKASARALLFVVDSSAFQREVKEVAELFYQLLTDVAILKNVPPILIACNKQDISMAKSAKLIQQQLEKELNTLRVTRSAAPSILESGNSGVTQLGKKGKDFDFTQLPMKVKFLECSTRDSKEEDGDANISNVEGWLAKLV
Donor tissue: neurula