ORFeome > ssr1-prov – XORFeome 2.0

ssr1-prov – XORFeome 2.0

General Information

Species: Xenopus tropicalis signal sequence receptor, alpha (translocon-associated protein alpha), mRNA (cDNA clone MGC:75590 IMAGE:5379202), complete cds
Gene Symbol: ssr1-prov
Gene ID: 549666
ORF gb_acc: MG133444
ORF ID: 10961

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC068212

Library Location

Plate ID: GDExt11009
Well Location: D09

EST Sequences

Clone: MGC:75590 IMAGE:5379202
Trimmed Sequence: ATGATCCCGCTCCGCAATCTGCTCCTACTCGTCCTCCTGGCCTTCCCGGTCACTCTCATCGGCAACAGCAAAGGTCCTCTGGTTGCTGCCCAAGATGCAACAGAAGATGAAGAAGCAATTGATGATTCTGTAGTAGAAGATGATGATGATGAAGCTGAAGTCGAGGAAGATGATACAACAGACCTGACAGAAGAAAAGGAGGAAGAAGAAGACTTGAGTTCTGGGGAGCCAAAAGCATCCCCCAATGCTGACACCACTATTCTTTTTGTAAAAGGCGAAGATTTCCCAGCCAATGACATTGTAAAGTTCTTGGTGGGCTTCACCAACAAGGGGCCAGAAAACTTCATTGTTGAGTCACTGGATGCCTCATTCAGATACCCTCAAGACTACCAGTTCTATATTCAGAATTTTACAGCTCTGCCTTTAAACACTGTTGTCCCCCCACAAAAACAGGCTACATTTGAATATTCATTTATTCCTGCTGAGCCCATGGGAGGACGCCCTTTTGGACTTGTCATCAATTTGAACTATAAAGATGCAAATGGAAATGCTTTCCAAGATGCTGTCTTTAATCAGACTGTTACTATTACTGAGAAGGAGGATGGTCTGGATGGGGAAACGATATTCATGTACCTGTTCCTTGGTGGGCTCGGATTGCTTGTGATTGTTGGTTTGCATCAGCTGCTGGAATCCAGAAAGAGAAAGAGACCAGCTCAAAAAGTGGAGATGGGCACTTCAAACCAAAATGATGTGGATATGAGTTGGATTCCCCCTGAGACTTTGAGCCAGATCATGCAAAGTAGACGAGATAAGGCTTCTCCAAGAAGGTCTCCTCGCAAACGAGGCCCCAAAAGACCGGCAGGATCTGATGAATAA
Full Trace Sequence: tagaaaggagggactgacacctctcggcctcctttcggactaaggttttcatacacacatacacgcacaccggccttcgccatgatcccgctccgcaatctgctcctactcgtcctcctggccttcccggtcactctcatcggcaacagcaaaggtcctctggttgctgcccaagatgcaacagaagatgaagaagcaattgatgattctgtagtagaagatgatgatgatgaagctgaagtcgaggaagatgatacaacagacctgacagaagaaaaggaggaagaagaagacttgagttctggggagccaaaagcatcccccaatgctgacaccactattctttttgtaaaaggcgaagatttcccagccaatgacattgtaaagttcttggtgggcttcaccaacaaggggccagaaaacttcattgttgagtcactggatgcctcattcagataccctcaagactaccagttctatattcagaattttacagctctgcctttaaacactgttgtccccccacaaaaacaggctacatttgaatattcatttattcctgctgagcccatgggaggacgcccttttggacttgtcatcaatttgaactataaagatgcaaatggaaatgctttccaagatgctgtctttaatcagactgttactattactgagaaggaggatggtctggatggggaaacgatattcatgtacctgttccttggtgggctcggattgcttgtgattgttggtttgcatcagctgctggaatccagaaagagaaagagaccagctcaaaaagtggagatgggcacttcaaaccaaaatgatgtggatatgagttggattccccctgagactttgagccagatcatgcaaagtagacgagataaggcttctccaagaaggtctcctcgcaaacgaggccccaaaagaccggcaggatctgatgaataaaaagactttttgctctgcaatttattttgtccactaattttgctctcctgctacccaagacggttaccacactaaatcaatgctggcatcaccgagtaggaagggcggctagtccatgaaagatattgacccattgaattcaattttcttctctcaatgattgtacatgtttctttcccacggtcggtcgaatccctgattaaagcatcatctgaatgttagagtgaaaaagccagcgtctgtatgtgtgcagctcagttggcagaatggggttgttttttgcataccctctttgcatctttcttctatatgcacagaaactcgaaatgactgattcatgtctatagataaatctgggatttctcgacatggttgggctaaattgtgtttcgtcaaagattttcgcttgcatctccatgtctgggattccagcagttcaatgtgacagattacttgtttattggagcctttgtgctggtcatcatttttactgccaggggagtgatgctaaagtttggctgcagcacatgaacacatcggccagtgcttcataaagcgccatgaggctaagccattatcatagcggccaaacttttgatttcagacctatttatgccaaacttttctctgatgtttgtaatacagggggcaggagggggctgagaacataatttgctgtacagaatttgtgcagagttgtaaaggtaaaatgcattgcattttggaaataacgcaatgcacaagtaattcagaaagcccttgaagaaaattgggaaggttttttttttttttttttttttttttcttgttttgatttatttttgggggaatttttttttttaatggaggaattggcttgaacattgtttgcctatgtgtacaaaaaaataaattcttcaataaatatcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MIPLRNLLLLVLLAFPVTLIGNSKGPLVAAQDATEDEEAIDDSVVEDDDDEAEVEEDDTTDLTEEKEEEEDLSSGEPKASPNADTTILFVKGEDFPANDIVKFLVGFTNKGPENFIVESLDASFRYPQDYQFYIQNFTALPLNTVVPPQKQATFEYSFIPAEPMGGRPFGLVINLNYKDANGNAFQDAVFNQTVTITEKEDGLDGETIFMYLFLGGLGLLVIVGLHQLLESRKRKRPAQKVEMGTSNQNDVDMSWIPPETLSQIMQSRRDKASPRRSPRKRGPKRPAGSDE
Donor tissue: tailbud