ORFeome > stip1 – XORFeome 2.0

stip1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis stress-induced-phosphoprotein 1 (Hsp70/Hsp90-organizing protein), mRNA (cDNA clone MGC:76181 IMAGE:5335741), complete cds
Gene Symbol: stip1
Gene ID: 394990
ORF gb_acc: MG132687
ORF ID: 9977

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064232

Library Location

Plate ID: GDExt11001
Well Location: F04

EST Sequences

Clone: MGC:76181 IMAGE:5335741
Trimmed Sequence: ATGGAGGCGGCAAACGCACTGAAAGAGAAAGGAAACAAAGCACTTTCAGCAGGGGATCTGGATGAAGCAGTCAAATGCTACACCGAAGCCATCAAACTTGACCCTAAAAATCACGTCCTGTACAGCAATCGTTCTGCAGCCTTTGCCAAAAAGAAAGAGTTCACCAAAGCACTGGAAGATGGCGGCAAAACCGTGGAGCTGAAACCAGACTGGGGGAAGGGTTACTCTAGGAAAGCAGCAGCTTTAGAATTTCTGAATCGTTTTGAAGAAGCAAAGAAAACTTATGAAGAGGGGCTGAGGCACGAGCCAGCAAATGCACAGCTGAAAGAAGGGCTGCAAAATATGGAGGCCAGGCTGGCAGAGAGAAAATTCATGAATCCCTTCAACTCTCCAAACTTATACCAAAAACTGGAGTCTGATCCTCGTACCCGTGCGTTGCTGAGTGACCCCAGTTACAAAGAACTGATTGAACAGTTGAAAAACAAACCATCTGATCTTGGCACGAAGCTGCAAGACCCAAGGGTGATGACAACCCTTAGTGTTCTGCTTGGAGTAGAGCTAGGTAATGTTGAGGAGGAGGAGGAGGATACACCTCCACCACCACCTCCCCAACCTAAAAAAGAGACCAAACCTGAACCAATGGAGGAAGACTTGCCTGAAAATAAAAAGCAGGCCCAGAAGGAAAAAGAGTTGGGCAATGAAGCTTATAAGAAGAAGGACTTTGAGACAGCTCTAAAACATTATGGCCAAGCTCAGGAGTTGGATCCAACCAATATGACCTACATAACTAATCAAGCAGCTGTATACTTCGAGCAGGGAGATTACAATAAATGTAGAGAGCTGTGTGAAAAGGCAATTGAAGTAGGAAGAGAGAATCGCGAAGACTACCGACAAATTGCCAAAGCCTATGCTCGCATCGGTAATTCTTATTTTAAGGAGGAGAAGAACAAAGAGGCGATTCATTTCTTCAACAAGTCACTAGCAGAGCACAGGACGCCAGAGGTTCTAAAGAAATGCCAGCAGGCAGAAAAAATTTTAAAGGAACAGGAACGTCTTGCATATATAAACCCAGACTTAGCCTTAGAAGAGAAAAGTAAAGGGAATGAAAGTTTCCAGAAAGGAGACTACCCGCAAGCTATGAAACATTACACAGAGGCCATCAAAAGGAATCCAAATGATGCTAAACTGTATAGCAACAGAGCAGCTTGCTACACCAAACTACTGGAGTTTCAGCTGGCTCTTAAGGACTGTGAGGAGTGTATAAGGCTGGAACCCAAATTCATAAAAGGTTACACACGTAAAGCTGCAGCCCTGGAGGCCATGAAAGATTACAGCAAGGCTATGGATGTATATCAGAAAGCTATGGAGCTGGACTCTACTTGTAAGGAGGCCACCGATGGGTACCAGCGCTGCATGATGTCACAATACCACCGCAATGACAGTCCTGAGGATGTGAAGCGCAGGGCTATGGCAGATCCAGAGGTGCAGCAAATAATGAGCGATCCAGCCATGAGGCTTATCCTTGAGCAGATGCAGAAGGACCCACAAGCACTAAGCGAACATCTTAAAAACCCAGTTATCGCCCAGAAAATACAGAAGTTGATGGATGTTGGTTTGATTGCCATCCGGTGA
Full Trace Sequence: gttgcaatggaggcggcaaacgcactgaaagagaaaggaaacaaagcactttcagcaggggatctggatgaagcagtcaaatgctacaccgaagccatcaaacttgaccctaaaaatcacgtcctgtacagcaatcgttctgcagcctttgccaaaaagaaagagttcaccaaagcactggaagatggcggcaaaaccgtggagctgaaaccagactgggggaagggttactctaggaaagcagcagctttagaatttctgaatcgttttgaagaagcaaagaaaacttatgaagaggggctgaggcacgagccagcaaatgcacagctgaaagaagggctgcaaaatatggaggccaggctggcagagagaaaattcatgaatcccttcaactctccaaacttataccaaaaactggagtctgatcctcgtacccgtgcgttgctgagtgaccccagttacaaagaactgattgaacagttgaaaaacaaaccatctgatcttggcacgaagctgcaagacccaagggtgatgacaacccttagtgttctgcttggagtagagctaggtaatgttgaggaggaggaggaggatacacctccaccaccacctccccaacctaaaaaagagaccaaacctgaaccaatggaggaagacttgcctgaaaataaaaagcaggcccagaaggaaaaagagttgggcaatgaagcttataagaagaaggactttgagacagctctaaaacattatggccaagctcaggagttggatccaaccaatatgacctacataactaatcaagcagctgtatacttcgagcagggagattacaataaatgtagagagctgtgtgaaaaggcaattgaagtaggaagagagaatcgcgaagactaccgacaaattgccaaagcctatgctcgcatcggtaattcttattttaaggaggagaagaacaaagaggcgattcatttcttcaacaagtcactagcagagcacaggacgccagaggttctaaagaaatgccagcaggcagaaaaaattttaaaggaacaggaacgtcttgcatatataaacccagacttagccttagaagagaaaagtaaagggaatgaaagtttccagaaaggagactacccgcaagctatgaaacattacacagaggccatcaaaaggaatccaaatgatgctaaactgtatagcaacagagcagcttgctacaccaaactactggagtttcagctggctcttaaggactgtgaggagtgtataaggctggaacccaaattcataaaaggttacacacgtaaagctgcagccctggaggccatgaaagattacagcaaggctatggatgtatatcagaaagctatggagctggactctacttgtaaggaggccaccgatgggtaccagcgctgcatgatgtcacaataccaccgcaatgacagtcctgaggatgtgaagcgcagggctatggcagatccagaggtgcagcaaataatgagcgatccagccatgaggcttatccttgagcagatgcagaaggacccacaagcactaagcgaacatcttaaaaacccagttatcgcccagaaaatacagaagttgatggatgttggtttgattgccatccggtgatgaatttcaccattagttctttcctacttgttaagtcagcctccatggcgtctccttacctgctcattccttactgagaggctctacagttgtgcagtagctctatggaaggacttgcagtgtgattaaatcaaaagcagagccagacttgcccttctttcttgttccgtcaatctctgttcatgtttatcagcctgtcatattgttaataaagatcagcacgccacagtagtgccgaattcctagcagaaaaaaaaaaaaaaaaaaaa
Translation: MEAANALKEKGNKALSAGDLDEAVKCYTEAIKLDPKNHVLYSNRSAAFAKKKEFTKALEDGGKTVELKPDWGKGYSRKAAALEFLNRFEEAKKTYEEGLRHEPANAQLKEGLQNMEARLAERKFMNPFNSPNLYQKLESDPRTRALLSDPSYKELIEQLKNKPSDLGTKLQDPRVMTTLSVLLGVELGNVEEEEEDTPPPPPPQPKKETKPEPMEEDLPENKKQAQKEKELGNEAYKKKDFETALKHYGQAQELDPTNMTYITNQAAVYFEQGDYNKCRELCEKAIEVGRENREDYRQIAKAYARIGNSYFKEEKNKEAIHFFNKSLAEHRTPEVLKKCQQAEKILKEQERLAYINPDLALEEKSKGNESFQKGDYPQAMKHYTEAIKRNPNDAKLYSNRAACYTKLLEFQLALKDCEECIRLEPKFIKGYTRKAAALEAMKDYSKAMDVYQKAMELDSTCKEATDGYQRCMMSQYHRNDSPEDVKRRAMADPEVQQIMSDPAMRLILEQMQKDPQALSEHLKNPVIAQKIQKLMDVGLIAIR
Donor tissue: tailbud