ORFeome > stk4 – XORFeome 2.0

stk4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis serine/threonine kinase 4, mRNA (cDNA clone MGC:75656 IMAGE:5379714), complete cds
Gene Symbol: stk4
Gene ID: 394860
ORF gb_acc: MG132787
ORF ID: 10108

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063903

Library Location

Plate ID: GDExt11002
Well Location: B02

EST Sequences

Clone: MGC:75656 IMAGE:5379714
Trimmed Sequence: ATGGAGACCGTACAGCTGCGGAACAACCCCAGAAGGCATCTGAAGAAGCTAAGCGAAGAAAGTCTCAATAAGCAGCCGGAAGAAGTTTTTGATGTCCTCGAAAAACTTGGGGAGGGGTCCTATGGCAGCGTATATAAAGCAAGCCACAAGGAAACAAGTCAGATTGTTGCAATTAAGCAGATTCCCGTTGAGTCTGATCTTCAAGAGATTATCAAGGAAATAGCCATCATGCAGCAGTGTGATAGCCTCCACGTTGTGAAGTATTACGGGAGCTATTTTAAAAACACAGACCTGTGGATCGTCATGGAGTTCTGTGGAGGGGGATCCATTTCTGACATTATCCGACTCCGCAAACAAACGTTGAAAGAAGATGAAACTGCAACTATTTTGCAGTCAACTCTCAAGGGACTGGAGTATCTTCACTTTATGAGAAAGATTCACAGAGATATAAAAGCTGGGAATATATTACTGAATTCTGAAGGCACCGCCAAGCTCGCCGACTTCGGAGTGGCCGGGCAGCTCACAGATACAATGGCAAAAAGGAACACAGTCATCGGGACACCGTTTTGGATGGCTCCAGAAGTGATCCAGGAAATCGGATACAATTGTGTTGCTGACATATGGTCCCTTGGTATCACTGCAATTGAAATGGCGGAAGGAAAGCCACCATACGCTGAAATTCATCCAATGAGGGCGATATTTATGATACCTTCCAACCCACCCCCTACATTTAGAAAACCTGAACTTTGGTCAAAGGATTTTGTGGACTTTATTAACCTGTGTCTTGTGAAGAACCCCGAACTGAGGTCCAGTGCCACCGAGCTTCTGCAGCACCCATTCATCAAAACAGCCAAAGGGGAGTCCATTTTACGTCACTTAATAAACGAAGCCCAGGATGCAAAGCTGAAGAGGACTGAACTGAAACAGAGAGAAGTGGAGCCTGAAGAGGAGGAGAATGCGGATGAGGATGAAGCAGACGTGGGCACCATGGTCCAAGCAGGCAGCAAAGATCTGAACACAATGAAAGAGTTTAGTACAATGAATGAAGCAGCAGATTGCACCATGGTGGAAAAGGACAAACTGAACACCCAGATGGGCACCATGCTGATAAATGATGAAGATGAGGAGGAAACGGGTACAATGAAACAATGCACTGAGCCGGTACAGCCAGCCAAACCCTCATTTCTGGAATATTTTGAGCAAAAGGAAAACCAGTTTGGCACCCCGGAAAAGACAACTCCGGCCCCATCTACGGACCCCTCGGAATGGAAAATACCACTCAATGGAGACTATAGCTTTCTGAAAGACTGGAGTGTGACTGAGCTTCAGCTGAGACTGAATTCCCTGGATCCCATGATGGAACAAGAGATTGAAGAAATACATCACAAGTATCAAGCCAAGCGGCAGCCAATCCTGGAGGCCATAGAGTCCAAGAAACGCAGGCAACAGAACTTCTAA
Full Trace Sequence: cttccgtctgctagagatgcagccgctgctgtctgctctgctcttctgggaggaaatggtgaggtgagactgcaaggtgcagggagtttcatgtacactgaccggagcaggagcctggcctccatgctgtgcccttaccctgcttgctggattgtgagtgccgggccaaaggatggagaccgtacagctgcggaacaaccccagaaggcatctgaagaagctaagcgaagaaagtctcaataagcagccggaagaagtttttgatgtcctcgaaaaacttggggaggggtcctatggcagcgtatataaagcaagccacaaggaaacaagtcagattgttgcaattaagcagattcccgttgagtctgatcttcaagagattatcaaggaaatagccatcatgcagcagtgtgatagcctccacgttgtgaagtattacgggagctattttaaaaacacagacctgtggatcgtcatggagttctgtggagggggatccatttctgacattatccgactccgcaaacaaacgttgaaagaagatgaaactgcaactattttgcagtcaactctcaagggactggagtatcttcactttatgagaaagattcacagagatataaaagctgggaatatattactgaattctgaaggcaccgccaagctcgccgacttcggagtggccgggcagctcacagatacaatggcaaaaaggaacacagtcatcgggacaccgttttggatggctccagaagtgatccaggaaatcggatacaattgtgttgctgacatatggtcccttggtatcactgcaattgaaatggcggaaggaaagccaccatacgctgaaattcatccaatgagggcgatatttatgataccttccaacccaccccctacatttagaaaacctgaactttggtcaaaggattttgtggactttattaacctgtgtcttgtgaagaaccccgaactgaggtccagtgccaccgagcttctgcagcacccattcatcaaaacagccaaaggggagtccattttacgtcacttaataaacgaagcccaggatgcaaagctgaagaggactgaactgaaacagagagaagtggagcctgaagaggaggagaatgcggatgaggatgaagcagacgtgggcaccatggtccaagcaggcagcaaagatctgaacacaatgaaagagtttagtacaatgaatgaagcagcagattgcaccatggtggaaaaggacaaactgaacacccagatgggcaccatgctgataaatgatgaagatgaggaggaaacgggtacaatgaaacaatgcactgagccggtacagccagccaaaccctcatttctggaatattttgagcaaaaggaaaaccagtttggcaccccggaaaagacaactccggccccatctacggacccctcggaatggaaaataccactcaatggagactatagctttctgaaagactggagtgtgactgagcttcagctgagactgaattccctggatcccatgatggaacaagagattgaagaaatacatcacaagtatcaagccaagcggcagccaatcctggaggccatagagtccaagaaacgcaggcaacagaacttctaaaagtcttaaaagcacctctcatatatgggctactgacccacagatacatgtacacgtaacgcacacgcttacacgcatacacacacctacacgcttacacgcacacacaaacctacactcatacacacctacacacacacctacacgcacacacctacacgcttacacgcacacacaaacctacactcatacacacctacacacacacctacatgcacacgcttacacgcacacacacacacacacacctacatgcacacacaaacctacactcatacacacctacacgcacacacacgcttacacgcacacacagcatcacattactcaggttatattccagtttgccttgacttgccattacatggattagtacttgattttcttaaagaggaaaaaaaaaatgaccggtacattttcataaagaattttttttaaaagtttaaaaaaatatatatatatttgttgctatagaaagctaagattaaatccattcaatacggtaccagacccagtgggcgaaaagagcttttagcctgatgtaaataatttttttatgtaatgatatttttggagcattcactgttaaaataatatgtattttatatcttaaataaatgatagaaactcaaaaaaaaaaaaaaaaaaaaaaaaaaacaaaaaaaaaaaaaaa
Translation: METVQLRNNPRRHLKKLSEESLNKQPEEVFDVLEKLGEGSYGSVYKASHKETSQIVAIKQIPVESDLQEIIKEIAIMQQCDSLHVVKYYGSYFKNTDLWIVMEFCGGGSISDIIRLRKQTLKEDETATILQSTLKGLEYLHFMRKIHRDIKAGNILLNSEGTAKLADFGVAGQLTDTMAKRNTVIGTPFWMAPEVIQEIGYNCVADIWSLGITAIEMAEGKPPYAEIHPMRAIFMIPSNPPPTFRKPELWSKDFVDFINLCLVKNPELRSSATELLQHPFIKTAKGESILRHLINEAQDAKLKRTELKQREVEPEEEENADEDEADVGTMVQAGSKDLNTMKEFSTMNEAADCTMVEKDKLNTQMGTMLINDEDEEETGTMKQCTEPVQPAKPSFLEYFEQKENQFGTPEKTTPAPSTDPSEWKIPLNGDYSFLKDWSVTELQLRLNSLDPMMEQEIEEIHHKYQAKRQPILEAIESKKRRQQNF
Donor tissue: tailbud