ORFeome > stx5a – XORFeome 2.0

stx5a – XORFeome 2.0

General Information

Species: Xenopus tropicalis stx5a protein, mRNA (cDNA clone MGC:90009 IMAGE:7026554), complete cds
Gene Symbol: stx5a
Gene ID: 493353
ORF gb_acc: MG133057
ORF ID: 10462

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080503

Library Location

Plate ID: GDExt11005
Well Location: D08

EST Sequences

Clone: MGC:90009 IMAGE:7026554
Trimmed Sequence: ATGTCCTGTCGGGACCGCACTGCTGAGTTCATTTCTGCTTGCAAATCTCTGCAGGGACGCCAGAATGGTGTACAGTTGTCATCTCCGACTCTAAGTGCTGTTAAGCAAAGAAGTGAATTCACCCTAATGGCCAAACGCATTGGAAAGGATCTCAGTAACACATTTAGCAAACTGGAGAAACTGACAATATTGGCAAAACGAAAATCACTTTTTGATGACAAAGCTGCAGAGATTGAAGAATTGACCTACATAATTAAACAAGATATAGGAAGTCTGAACCAGCAGATTGCTCAGCTCCAGTCTTTTGTCCGTGCTCGTGGCAGTCAAAGTGGGCGACATCTTCAGACTCATTCAAATACGGTTGTGGTCTCCCTGCAGTCAAAGCTTGCATCAATGTCTAATGATTTCAAGTCGGTTTTGGAAGTTAGGACAGAGAACCTAAAGCAACAGAGGAGTCGAAGGGAACACTTCTCTCAAGGCCAGGTGGCACTCCCACTTCATCATAATAGCCTAGGTCCCTCGGTTCTTCTTCAGGATGACTCTCGCAGACAGGGAGATGTGACTATAGAAATGGATTCCAGAGTTAGTCAGCAGCTGCAGCTTATTGATGAGCAGGACTCATACATCCAAAGTCGAGCAGACACCATGCAGAATATAGAATCTACAATAGTAGAACTGGGATCCATATTTCAGCAGCTGGCTCATATGGTAAAGGAGCAGGAAGAGACTATACAAAGGATTGATGGAAATGTAGAAGACACTCAGTTAAACGTGGAGGGCGCCCATCAAGAGATCCTGAAGTATTTCCAATCTGTCACATCGAACCGCTGGCTTATGATCAAGATTTTCCTCATACTTATTGTCTTCTTCATAATCTTTGTAGTCTTCCTTGCTTAA
Full Trace Sequence: ccggcgctgacgtcagcattttccccggcagaaacagaaagagagagggagtaagagagaagcggtgaccgctggtcctggccccatgaacgctcgtaaacgtctcgggtcccgtaacacagacaacggaatatacataggaccatcccagactcaggtcctggttcctgcttcagagtttcctgttgctcctcttccagttcccccagctgacatcatgtcctgtcgggaccgcactgctgagttcatttctgcttgcaaatctctgcagggacgccagaatggtgtacagttgtcatctccgactctaagtgctgttaagcaaagaagtgaattcaccctaatggccaaacgcattggaaaggatctcagtaacacatttagcaaactggagaaactgacaatattggcaaaacgaaaatcactttttgatgacaaagctgcagagattgaagaattgacctacataattaaacaagatataggaagtctgaaccagcagattgctcagctccagtcttttgtccgtgctcgtggcagtcaaagtgggcgacatcttcagactcattcaaatacggttgtggtctccctgcagtcaaagcttgcatcaatgtctaatgatttcaagtcggttttggaagttaggacagagaacctaaagcaacagaggagtcgaagggaacacttctctcaaggccaggtggcactcccacttcatcataatagcctaggtccctcggttcttcttcaggatgactctcgcagacagggagatgtgactatagaaatggattccagagttagtcagcagctgcagcttattgatgagcaggactcatacatccaaagtcgagcagacaccatgcagaatatagaatctacaatagtagaactgggatccatatttcagcagctggctcatatggtaaaggagcaggaagagactatacaaaggattgatggaaatgtagaagacactcagttaaacgtggagggcgcccatcaagagatcctgaagtatttccaatctgtcacatcgaaccgctggcttatgatcaagattttcctcatacttattgtcttcttcataatctttgtagtcttccttgcttaacatcactctaggaaattgtgaagtagtttcttccccccaaacacagcacacagtgtcctacttacccatgaaccaccctgccacttagaagggttactttctggttagtctgtggataaatgtgggaggacagaggttaacacacttacggatacactgtgtatatatgtaatgtaaggatgagtatgctaagtgtgattgagcaaggccatgcatatatgtgtgtgaataaatcaaattattataggcatatatattttagacagtttgcagttaaacacacatgcacagtcagacttttgtactgtgaatgaggtgtgtgtgttctcatgcacactttatgttttaagagtgtgtgtttacagttttaggtatgaatacatacatatttacacacacacacacacacacacaatgtgtttaaaggccttgtattaatagcggtgtgcatgtatgtgtggttcctcttattaagtgtcttattgggcttcctccactgaataaggcaagtggaacctgcttcttgtggggagggagataagtggctttgtccaaggctgtattagtgagagctgacaatatgtacaggccaggcacgcttgttttaatctcttgtaaacaatgtaatattctgtttttaaattattcttggaaaaaaaaaaaaaaaa
Translation: MSCRDRTAEFISACKSLQGRQNGVQLSSPTLSAVKQRSEFTLMAKRIGKDLSNTFSKLEKLTILAKRKSLFDDKAAEIEELTYIIKQDIGSLNQQIAQLQSFVRARGSQSGRHLQTHSNTVVVSLQSKLASMSNDFKSVLEVRTENLKQQRSRREHFSQGQVALPLHHNSLGPSVLLQDDSRRQGDVTIEMDSRVSQQLQLIDEQDSYIQSRADTMQNIESTIVELGSIFQQLAHMVKEQEETIQRIDGNVEDTQLNVEGAHQEILKYFQSVTSNRWLMIKIFLILIVFFIIFVVFLA
Donor tissue: