ORFeome > supt3h – XORFeome 2.0

supt3h – XORFeome 2.0

General Information

Species: Xenopus tropicalis suppressor of Ty 3 homolog (S. cerevisiae), mRNA (cDNA clone MGC:75923 IMAGE:5383729), complete cds
Gene Symbol: supt3h
Gene ID: 394640
ORF gb_acc: MG132982
ORF ID: 10362

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061367

Library Location

Plate ID: GDExt11004
Well Location: A09

EST Sequences

Clone: MGC:75923 IMAGE:5383729
Trimmed Sequence: ATGAGCCACGGCGCTGCGGGGCCCAACACAATGGCATCAGCTGGCACATCATCATCTGGAAGAGGAATAGGGAAGACAACAAGCTTTGTTCCCGAACTCCAGAGTATGATGTTCTCCTTGGGTGATGCCCGGCGCCCGTTACATGAAACCGCCGTCCTGGTAGAAGACATTGTTCACACCCAGCTTATCAACTTGTTGCAGCAGGCAGCCGAAGTGTCCCAGATGAGGGGCGCGCGGGTCATTTCTGCCGAAGATCTCCTTTTCCTCATGCGTCGCGATAAGAAGAAACTGCGGAGGTTGCTGAAATACATGGTCTTCCGTGACTACAAGTCCAAGGTCTTAAAAGGAATCGAAGAAGAGGATATTGAAGAGAAGTTCAACAGCAGCAACAACAACGCCAATAAACGTCAGAAGCTGGCGCAGGACTTTCTCAACTCCATCGACCAGACAGGAGAGCTCCTAGCCTTGATGGAAGATGATGAGATTGATGAGGTCAAGCAGGAACGGATGGAGAGAGCCGAGAAACAAACCCGAGCAATGGACCCGGCGCAGTATGCAGAATTCTGTGAGAGCCGGCAGCTGAGCTTCTCCAAGAAGGCCTCTAAATTCCGGGACTGGCTGGATTGCAGCAGCATGGAGATCAAGCCGAACGCTGTAGCCATGGAGATCCTGGCCTACTTGGCATATGAATCTGTAGCCCAGTTAGTGGACTTGGCTCTGTTGGTTAAACAAGATATGACTCCCAAGACTTGTGACCCATTCACACATGCAGTGTCGGCCACCTACATCCAGAGCCGCAACACAGCAGAGCTGCTTGCCCAGACAGCACCTCTGAAAAGTTGCCCTGACACCCCAGAGAACACACCTCCAGCCACACCCAACCCTCCCTCTGTCGGAGCCCAACACCAGGGTAAGGGCCAAGCTGGAGCTCTTGGGAATGGTGTGGACTCCAACAAAGCCAAACAGAGGAAAAGAAAAAAGAGCGCAGCTGCCGGTGGGACGGAGGCAAACAGCGATGCCATCCAGCCCGGCCACATCAGAGAGGCCATTCGGCGCTACAGCCACAAGATTGGCCCCCTCTCTCCGTTCACGAGCGCTTACCGCAGGACCGGGATGCCTTTTTTAGCCTGCTAA
Full Trace Sequence: gcttggggcagttgaatgcccttctgcagagggatattggaaacaggctaacctctacatttccttggcaagatgagccacggcgctgcggggcccaacacaatggcatcagctggcacatcatcatctggaagaggaatagggaagacaacaagctttgttcccgaactccagagtatgatgttctccttgggtgatgcccggcgcccgttacatgaaaccgccgtcctggtagaagacattgttcacacccagcttatcaacttgttgcagcaggcagccgaagtgtcccagatgaggggcgcgcgggtcatttctgccgaagatctccttttcctcatgcgtcgcgataagaagaaactgcggaggttgctgaaatacatggtcttccgtgactacaagtccaaggtcttaaaaggaatcgaagaagaggatattgaagagaagttcaacagcagcaacaacaacgccaataaacgtcagaagctggcgcaggactttctcaactccatcgaccagacaggagagctcctagccttgatggaagatgatgagattgatgaggtcaagcaggaacggatggagagagccgagaaacaaacccgagcaatggacccggcgcagtatgcagaattctgtgagagccggcagctgagcttctccaagaaggcctctaaattccgggactggctggattgcagcagcatggagatcaagccgaacgctgtagccatggagatcctggcctacttggcatatgaatctgtagcccagttagtggacttggctctgttggttaaacaagatatgactcccaagacttgtgacccattcacacatgcagtgtcggccacctacatccagagccgcaacacagcagagctgcttgcccagacagcacctctgaaaagttgccctgacaccccagagaacacacctccagccacacccaaccctccctctgtcggagcccaacaccagggtaagggccaagctggagctcttgggaatggtgtggactccaacaaagccaaacagaggaaaagaaaaaagagcgcagctgccggtgggacggaggcaaacagcgatgccatccagcccggccacatcagagaggccattcggcgctacagccacaagattggccccctctctccgttcacgagcgcttaccgcaggaccgggatgccttttttagcctgctaatatggaggttgcataagaaacaggaaaaatcagagggttatattaaggtgatctcttcctctgtgaaaaaaaaaaaggaaaggaaggacaagttcccgtctgggcttctagtcggtgggattgtttgttgtgactatagacggactgactggatgtctcatattccaaccccctcagtcgctctacttgtttactagctggaacgttgggctaattaatggcaggatgtttgggatggtgcgtaggtgggggagtaggcacatcacacggctttgtcactgccaatgagaggatgactgtcagcccacgcggcccaactgcaccgtcatctcttctggcctgggtggagacactttcaacaacaatgttctcagctgggatcaaggaaaattatacagagttatttttgtcaccgtctacaaaaaatcctttccttaatatgcatctttttttctacatgtttctctgatcgtccattggaaatatttctgcatttttgttcattgttatcgctgcagtttgatatataaaataacccatatttttttgcattaaacactattatgattggatctttatgaaataaaaattgtgttgtttttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSHGAAGPNTMASAGTSSSGRGIGKTTSFVPELQSMMFSLGDARRPLHETAVLVEDIVHTQLINLLQQAAEVSQMRGARVISAEDLLFLMRRDKKKLRRLLKYMVFRDYKSKVLKGIEEEDIEEKFNSSNNNANKRQKLAQDFLNSIDQTGELLALMEDDEIDEVKQERMERAEKQTRAMDPAQYAEFCESRQLSFSKKASKFRDWLDCSSMEIKPNAVAMEILAYLAYESVAQLVDLALLVKQDMTPKTCDPFTHAVSATYIQSRNTAELLAQTAPLKSCPDTPENTPPATPNPPSVGAQHQGKGQAGALGNGVDSNKAKQRKRKKSAAAGGTEANSDAIQPGHIREAIRRYSHKIGPLSPFTSAYRRTGMPFLAC
Donor tissue: neurula