ORFeome > tm4sf4 – XORFeome 2.0

tm4sf4 – XORFeome 2.0

General Information

Species: Xenopus tropicalis transmembrane 4 superfamily member 4, mRNA (cDNA clone MGC:75723 IMAGE:5380972), complete cds
Gene Symbol: tm4sf4
Gene ID: 394555
ORF gb_acc: MG132957
ORF ID: 10333

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061278

Library Location

Plate ID: GDExt11003
Well Location: E06

EST Sequences

Clone: MGC:75723 IMAGE:5380972
Trimmed Sequence: ATGTGTTCTGGTGGTTGCGCAAAGTGCTTGGGCATTACCCTTATACCACTAGCCGTTCTGTGTTTGCTGGCTAATATATTATTATTTTTCCCTGGAGGAAAAGTTGCTGATAAAAATGAAAATATCTCAGATGAAGTCTGGTACTTTGGAGGAATAGTGGGCTCTGGAGTTCTGATGATTTTTCCAGCACTGGTGTTTCTGGGTCTAAAGAACAATGACTGCTGTGGCTGCTGTGGCAATGAGAGCTGTGGGAAAAGATTTGCTATGTTCACCTCTATAATATTTGCTGCCATTGGCTTTGTTGGAGCAGGCTACAGCTTTATTGTTTCAGCAGTTGCCATTAATAAGGGACCAAAATGTGATATTGGTGGTGGACCATTTATATATCCATTCAATAGCGGAGACTACTTGGGAAACACGACTTTGTGGAATGTTTGTAAAGGACCTGGTGATATTGTGACATGGAATTTGACTCTCTTCTGCTTGCTCCTAATAATGAGCGGTGTTCAAGCCGTACTCTGCGCCATTCAAGCTATCAACGGACTCATAGGAACAATCTGTGGGGACTGCAAATGCTGTGGATGTTGTGGGGGTGACGGTCCTGTTTAA
Full Trace Sequence: cttttggattcaaatccacttggaggcttttattttatttttaatttgtacagttgtttttttaacctgaaaaatgtgttctggtggttgcgcaaagtgcttgggcattacccttataccactagccgttctgtgtttgctggctaatatattattatttttccctggaggaaaagttgctgataaaaatgaaaatatctcagatgaagtctggtactttggaggaatagtgggctctggagttctgatgatttttccagcactggtgtttctgggtctaaagaacaatgactgctgtggctgctgtggcaatgagagctgtgggaaaagatttgctatgttcacctctataatatttgctgccattggctttgttggagcaggctacagctttattgtttcagcagttgccattaataagggaccaaaatgtgatattggtggtggaccatttatatatccattcaatagcggagactacttgggaaacacgactttgtggaatgtttgtaaaggacctggtgatattgtgacatggaatttgactctcttctgcttgctcctaataatgagcggtgttcaagccgtactctgcgccattcaagctatcaacggactcataggaacaatctgtggggactgcaaatgctgtggatgttgtgggggtgacggtcctgtttaactctactccgattctcagtaaatccgacagcagtctcttcatcaagcatggagaagatttctgtgcaggaatccagtacctccaatgaacactatacaaggaagattaaggatgatggacattcagctctgactaaatcttcagtcatttatacagactgtttaactatccaattactgcagcactgcagatcgtgccaccttgtttgtgcatcaaagtcattccttttttccatcagtaataactgaacatgcacaacttggttccatttaactccagcatgtcggccagttccagtgcatgtattattgcatcccagtttggtgagagggaacgtgcctcgcaatgctgcttttagaacggataatatttattgtttcacttttatacttcccaaggttcaacttattgaagtaaattgcccagcatagggcagcaatggctggagtttcaaaccattgctttaccagaaattgctctggaaacattataagcatgtccaaattgcagatataatgtcagccccacggattaaacgctatcaattcgcatatttttttgattggcttattccctgaaaaatacattttaacactcaaatgtgtttttaaaagtatgcctgaaagaagcaacattatttatgtatgcaaataatatatgatcaataaagaaatgttttttccaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MCSGGCAKCLGITLIPLAVLCLLANILLFFPGGKVADKNENISDEVWYFGGIVGSGVLMIFPALVFLGLKNNDCCGCCGNESCGKRFAMFTSIIFAAIGFVGAGYSFIVSAVAINKGPKCDIGGGPFIYPFNSGDYLGNTTLWNVCKGPGDIVTWNLTLFCLLLIMSGVQAVLCAIQAINGLIGTICGDCKCCGCCGGDGPV
Donor tissue: tadpole