ORFeome > tmed3 – XORFeome 2.0

tmed3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis transmembrane emp24 domain containing 3, mRNA (cDNA clone MGC:76316 IMAGE:5380149), complete cds
Gene Symbol: tmed3
Gene ID: 394874
ORF gb_acc: MG132861
ORF ID: 10215

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064279

Library Location

Plate ID: GDExt11002
Well Location: D09

EST Sequences

Clone: MGC:76316 IMAGE:5380149
Trimmed Sequence: ATGTGGAGGCTGCAAGGTCTAGTGAAGGAGTTCAGGTGGTGGTCCTTCCTTTCCTTCGTGTTGTTCAGTTTGGGATGTGTCAGAGCCTCAGAACTCACTTTTGAGCTGCCTGATAATGCCAAACAGTGCTTTTATGAGGACATCACTCAAGGGACCAAGTGTACACTGGAATTCCAGGTAATCACTGGTGGGCATTATGATGTAGACTGCAGACTAGAGGATCCTGATGGAATTGTATTGTACAAGGAGATGAAGAAGCAGTATGATAGTTTTACCTTTACCGCAACCCGCAATGGGACCTACAAGTTCTGCTTCAGTAATGAATTCTCCACATTCACACACAAGACAGTCTACTTTGATTTCCAGGTTGGAGATGACCCACCCCTATTTCCAAATGAGAACCGTGCTACTGCTCTTACTCAGATGGAATCTTCCTGTGTTTCCATCCATGAGGCACTGAAGTCTGTAATTGATTACCAGACACATTTTCGACTGAGGGAGGCACAGGGCCGCAGCAGAGCTGAAGATCTGAATAGCAGAGTAGCCTATTGGTCTATAGGAGAGGCTATTATCCTCCTTGTTGTAAGCATTGGACAAGTATTCTTGTTGAAAAGCTTCTTCTCAGATAAAAGAACCACTACAACTCGCGTTGGATCATAA
Full Trace Sequence: ccgctttccggctttgtgcatctaacccgctgccccagtcattctcttcctctgccacgccaacagcggctgcctgtcatccttacatccgggacattgccgcgctggttcttgaggctgtggaaagggacacaatgtggaggctgcaaggtctagtgaaggagttcaggtggtggtccttcctttccttcgtgttgttcagtttgggatgtgtcagagcctcagaactcacttttgagctgcctgataatgccaaacagtgcttttatgaggacatcactcaagggaccaagtgtacactggaattccaggtaatcactggtgggcattatgatgtagactgcagactagaggatcctgatggaattgtattgtacaaggagatgaagaagcagtatgatagttttacctttaccgcaacccgcaatgggacctacaagttctgcttcagtaatgaattctccacattcacacacaagacagtctactttgatttccaggttggagatgacccacccctatttccaaatgagaaccgtgctactgctcttactcagatggaatcttcctgtgtttccatccatgaggcactgaagtctgtaattgattaccagacacattttcgactgagggaggcacagggccgcagcagagctgaagatctgaatagcagagtagcctattggtctataggagaggctattatcctccttgttgtaagcattggacaagtattcttgttgaaaagcttcttctcagataaaagaaccactacaactcgcgttggatcataaccaatgtttctcaggatgctctgcttacgatactatttgcacccaactgcaaaggtttttttctttgttgtttttcctggttacctgtaagtaaagaactgtatatattggtaaaactatattttaccttttagactccactgtagctgaccctttaaaaaaaaaatgaaaaaaaaaaaagacaataaaatttaaaaaaaaaattagatttttggagagggtggtaacttttatttgaaatgtttttgggatgtttttttatttttaaattttgatttccatgttaaacattgaactctaaggttaatatattgtccatttctcaagaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MWRLQGLVKEFRWWSFLSFVLFSLGCVRASELTFELPDNAKQCFYEDITQGTKCTLEFQVITGGHYDVDCRLEDPDGIVLYKEMKKQYDSFTFTATRNGTYKFCFSNEFSTFTHKTVYFDFQVGDDPPLFPNENRATALTQMESSCVSIHEALKSVIDYQTHFRLREAQGRSRAEDLNSRVAYWSIGEAIILLVVSIGQVFLLKSFFSDKRTTTTRVGS
Donor tissue: tadpole