ORFeome > tmem45b – XORFeome 2.0

tmem45b – XORFeome 2.0

General Information

Species: Xenopus tropicalis transmembrane protein 45b, mRNA (cDNA clone MGC:89614 IMAGE:6995229), complete cds
Gene Symbol: tmem45b
Gene ID: 496521
ORF gb_acc: MG134336
ORF ID: 12020

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC084505

Library Location

Plate ID: GDExt11020
Well Location: H03

EST Sequences

Clone: MGC:89614 IMAGE:6995229
Trimmed Sequence: ATGGCGAATTTTAAAGGTCATGCCCTTCCAGGCAGCTTTTTCCTTGTGTTTGGCTTATGGTGGTCTGTGAAGTATCCCCTTAAATATCTGAATAGCAAGGTAAAAGGAAACTGTAGGTCCAACAAGTGCTATGAACGTTTGGAGCTCATTGAAGGAATACTTAAAGCGGCCTTTGCATTAATAGGGATTCTGGCAGAGCAGTTTGTTCCCGATGGGCCTCATATGCACCTTGTTAATGGTGAAGACCACAGCTGGGTAAAGCTAATGAACTGGCAGCATACAACTATGTACCTCTTTTATGGAATCTCAGGAGTAGTGGACATCCTGACTTTTCTTCCCCTAAATTTGCCGCGAGGCTTGGATCGTCTCAGCTTGGGAATAGCTGTGATTATTGAAGGTCTCCTGTTCTATTATCACGTCCATAATCGCCCGGCACTTGACCAACACATTCATTCTCTGCTCCTCATTGCTGTTTTTGGTGGTGCTATAAGTATTATGATAGAAGTGTTTATGAGAAATGATATTGTTCTGGAATTATTCCGTTCCAGTCTCACAATTCTCCAGGGAACATGGTTCTGGCAGATTGGGTTTGTGCTATACCCACTTGGAGGAGCACCAGAGTGGGACCAGACTGATCACGGGAACGTCATGTTTATCACAATGTGCTTCTGTTGGCATTATGCTGTGGCCTTGCTTATCATGGCTATCAACTATTCTTTGGTCTACTGTTGTGTAAAGAGGCACAAGAAGTTGTCTAGTGTTGTGGATAACAGCCTTAAGAAAATAAATTCAAACAAGACTGAAGTGGAAGCCTCCCTTCTAGCTGGCTCTGATGAAGAATGA
Full Trace Sequence: gcacctgcatgggaagagggtgctcctccctactcagcggcagaacaccatttagcagactctcgtactttcagagccctacaccgaggctgcctgtagctcccaggcataagtaaagatggcgaattttaaaggtcatgcccttccaggcagctttttccttgtgtttggcttatggtggtctgtgaagtatccccttaaatatctgaatagcaaggtaaaaggaaactgtaggtccaacaagtgctatgaacgtttggagctcattgaaggaatacttaaagcggcctttgcattaatagggattctggcagagcagtttgttcccgatgggcctcatatgcaccttgttaatggtgaagaccacagctgggtaaagctaatgaactggcagcatacaactatgtacctcttttatggaatctcaggagtagtggacatcctgacttttcttcccctaaatttgccgcgaggcttggatcgtctcagcttgggaatagctgtgattattgaaggtctcctgttctattatcacgtccataatcgcccggcacttgaccaacacattcattctctgctcctcattgctgtttttggtggtgctataagtattatgatagaagtgtttatgagaaatgatattgttctggaattattccgttccagtctcacaattctccagggaacatggttctggcagattgggtttgtgctatacccacttggaggagcaccagagtgggaccagactgatcacgggaacgtcatgtttatcacaatgtgcttctgttggcattatgctgtggccttgcttatcatggctatcaactattctttggtctactgttgtgtaaagaggcacaagaagttgtctagtgttgtggataacagccttaagaaaataaattcaaacaagactgaagtggaagcctcccttctagctggctctgatgaagaatgagactaagcaacaacgaacgaaattctgaagcaaacaattcagagatgagtctgcagaatttgtgttctaaaagttactgaacattgaacatctgcaaaccccactgactctgtggaaatttgggatgacttctttgctcaatgcttgtatatatttaatatatctggatctgtgaaacttccatacacattgttggactaaggactctttaacatatgcttttgatataaatgcagttattatattacatcttgtttacatattagtgagatgtgtatcatacgattactttgctatttaattgcatacactgtgtaaattttaatataacaaaatattatggtttacagagaaaaggcagaaaaataaagcacagcttaatgaagtataaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MANFKGHALPGSFFLVFGLWWSVKYPLKYLNSKVKGNCRSNKCYERLELIEGILKAAFALIGILAEQFVPDGPHMHLVNGEDHSWVKLMNWQHTTMYLFYGISGVVDILTFLPLNLPRGLDRLSLGIAVIIEGLLFYYHVHNRPALDQHIHSLLLIAVFGGAISIMIEVFMRNDIVLELFRSSLTILQGTWFWQIGFVLYPLGGAPEWDQTDHGNVMFITMCFCWHYAVALLIMAINYSLVYCCVKRHKKLSSVVDNSLKKINSNKTEVEASLLAGSDEE
Donor tissue: neurula