ORFeome > tmprss9 – XORFeome 2.0

tmprss9 – XORFeome 2.0

General Information

Species: Xenopus tropicalis transmembrane serine protease 9, mRNA (cDNA clone MGC:88934 IMAGE:7000247), complete cds
Gene Symbol: tmprss9
Gene ID: 448231
ORF gb_acc:
ORF ID: 11667

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075293

Library Location

Plate ID: GDExt11016
Well Location: H04

EST Sequences

Clone: MGC:88934 IMAGE:7000247
Trimmed Sequence: ATGGAGCTCACTGAGACCTTTCTGCTCCTGCTGGCCTTTGTCTCCCCCACAATTGTAAGTACAACTCCTGCGCCTCCGTCTTGTGGTTCCCCATTGGTCTCAAGTAGGATAGTGGGCGGGACTGATGCCAGAGAGGGGGCGTGGCCCTGGCAGGTCAGTCTGCGCTACAGAGGGTCCCACATCTGCGGGGGGTCCGTGATTGGCACTCAGTGGATTCTGACTGCCGCCCACTGCTTTGGAAATTCCCAGTCCCCATCAGACTATGAAGTTCGGCTGGGCGCCTACCGGTTGGCTGAGACAAGTCCCAATGAGATCACAGCCAAGGTGGATAGAATTATCATGCACCCCCAGTACGATGAATTAACTTATTTTGGAGATATTGCCTTAATCAGACTAACGAGCCCCATCGATTACACCGCGTACATCCTACCTGTCTGCCTGCCTTCAGCATCTAACAGCTTTACTGACGGAATGGAATGCTGGGTAACTGGATGGGGCAAAACTGCCTTTAATGTGAATCTACCATTTCCTGGCACCCTGCAAGAAGTGATGACCCCACTCATTAACAGGACAAGATGTGACCAAATGTACCACATTGACTCCCCGGTCAGTGCCAGTAGTGAGATAATTCCGTCAGACCAGATCTGTTCTGGATATTCCGATGGGGGAAAAGACTCCTGTAAGGGAGACTCAGGGGGGGCCCTTGTCTGTAAAATACAGAGAGTCTGGTATCAAATCGGCATTGTGAGTTGGGGAGATGGATGTGCCATTGCCAACCGACCTGGAGTTTATACCCTGGTGCCGGCCTACCAATCATGGCTCTCCTCATACAATGCAACAGAAAATACAATCAACGTAGACAATTCGGGCACCACAACAGCAGCAACCACCACACGGAGGGCAACCGTGACAACTGCATCTTCCGCATCATCTTCTGCATCATCATCTCCCGCATCATCATCTCCCGCATCATCTCCCGCATCATCTCCCGCATCATCATCTCCCACATCATCATCTCCCGCATCATCATCTCCCACATCATCATCTCCCGCATCATCTCCCGCGTCATCTTCCTCAACCTTTGTCTCCCCCACAATTCTAAGTACAACTCCTGCGCCTCCGGCTTGTGGTTCCCCATTGGTCTCAAGTAGAATAGTGGGCGGTACTGATGCCAGAGAGGGGGCGTGGCCCTGGCAGGTCAGTCTGCGCTATAGAGGGTCCCACATCTGCGGGGGGTCCGTGATTGGCACTCAGTGGATTCTGACTGCCGCCCACTGCTTTGAAAATTCCCAGTTCCCATCAGACTATGAGGTTCGGCTGGGCACCTACCGGTTGGCTCAGACAAGCCCCAATGAGATCACATACACGGTGGATAGAATTATTGTGAACTCCCAGTTTGACAGTTCAACTCTATTTGGCGACATTGCCTTAATCAGACTAACGAGCCCCATCACCTACACCAAGTACATCCTACCTGTCTGCCTGCCTTCAACATCTAACAGCTTTACTGACGGCATGGAATGCTGGGTAACTGGATGGGGAACAATTTCCTTATATGTGAATCTACCATATCCTAAGACCCTACAAGAAGTGATGACCCCACTCATTAACAGGACAAGATGTGACCAAATGTACCACATTGACTCCCCGGTCAGTGCCAGTAGTGAGATAATTCCGTCAGACCAGATTTGTTCTGGATATTCTGCTGGGGGAAAAGACTCCTGTAAGGGAGACTCCGGAGGACCCCTCGTCTGTAAATTACAGGGCATTTGGTATCAGATTGGCATTGTGAGTTGGGGAGAAGGATGTGCCATAGCCAAACGACCCGGTGTTTATACCCTGGTACCTGCTTACTACTCATGGGTCATTGCAGAAGAAAATACAGTTAATGTAGATAGTATTGGCACAACCAATAGTCTACCCACAACAACCACCACTGGCACCACCACATCCACCACCACCACCACTGGCACCACCACCACTGGCACCACCACATCCACCACCACCACCACTGGCACCACCACCACCACCACTGGCACCACCACCACCACACAGGGGTACAATAGGTCCTCCCCATCTTCCTTAAATAAATCAGTCCACCTGATTGGTGCCTGTTCCTTTTTATTAATCTGGCTCATTGTGGTGGCTGAGGGCCAATGA
Full Trace Sequence: cgcccatgtgttgctccatctctcctactgacattagtgacacaggaagacagtgacaaacatggagctcactgagacctttctgctcctgctggcctttgtctcccccacaattgtaagtacaactcctgcgcctccgtcttgtggttccccattggtctcaagtaggatagtgggcgggactgatgccagagagggggcgtggccctggcaggtcagtctgcgctacagagggtcccacatctgcggggggtccgtgattggcactcagtggattctgactgccgcccactgctttggaaattcccagtccccatcagactatgaagttcggctgggcgcctaccggttggctgagacaagtcccaatgagatcacagccaaggtggatagaattatcatgcacccccagtacgatgaattaacttattttggagatattgccttaatcagactaacgagccccatcgattacaccgcgtacatcctacctgtctgcctgccttcagcatctaacagctttactgacggaatggaatgctgggtaactggatggggcaaaactgcctttaatgtgaatctaccatttcctggcaccctgcaagaagtgatgaccccactcattaacaggacaagatgtgaccaaatgtaccacattgactccccggtcagtgccagtagtgagataattccgtcagaccagatctgttctggatattccgatgggggaaaagactcctgtaagggagactcagggggggcccttgtctgtaaaatacagagagtctggtatcaaatcggcattgtgagttggggagatggatgtgccattgccaaccgacctggagtttataccctggtgccggcctaccaatcatggctctcctcatacaatgcaacagaaaatacaatcaacgtagacaattcgggcaccacaacagcagcaaccaccacacggagggcaaccgtgacaactgcatcttccgcatcatcttctgcatcatcatctcccgcatcatcatctcccgcatcatctcccgcatcatctcccgcatcatcatctcccacatcatcatctcccgcatcatcatctcccacatcatcatctcccgcatcatctcccgcgtcatcttcctcaacctttgtctcccccacaattctaagtacaactcctgcgcctccggcttgtggttccccattggtctcaagtagaatagtgggcggtactgatgccagagagggggcgtggccctggcaggtcagtctgcgctatagagggtcccacatctgcggggggtccgtgattggcactcagtggattctgactgccgcccactgctttgaaaattcccagttcccatcagactatgaggttcggctgggcacctaccggttggctcagacaagccccaatgagatcacatacacggtggatagaattattgtgaactcccagtttgacagttcaactctatttggcgacattgccttaatcagactaacgagccccatcacctacaccaagtacatcctacctgtctgcctgccttcaacatctaacagctttactgacggcatggaatgctgggtaactggatggggaacaatttccttatatgtgaatctaccatatcctaagaccctacaagaagtgatgaccccactcattaacaggacaagatgtgaccaaatgtaccacattgactccccggtcagtgccagtagtgagataattccgtcagaccagatttgttctggatattctgctgggggaaaagactcctgtaagggagactccggaggacccctcgtctgtaaattacagggcatttggtatcagattggcattgtgagttggggagaaggatgtgccatagccaaacgacccggtgtttataccctggtacctgcttactactcatgggtcattgcagaagaaaatacagttaatgtagatagtattggcacaaccaatagtctacccacaacaaccaccactggcaccaccacatccaccaccaccaccactggcaccaccaccactggcaccaccacatccaccaccaccaccactggcaccaccaccaccaccactggcaccaccaccaccacacaggggtacaataggtcctccccatcttccttaaataaatcagtccacctgattggtgcctgttcctttttattaatctggctcattgtggtggctgagggccaatgaaagtttgggatttcttatcgtcgtagccactcctacctggaacataaagaatatctcaagtctagatccaagatggcggcacctccgctgttttctggagcacatatttgtatccagtcttatagacatgattgtgctttctgtgtaatttaataaactgatttatttaccttgaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MELTETFLLLLAFVSPTIVSTTPAPPSCGSPLVSSRIVGGTDAREGAWPWQVSLRYRGSHICGGSVIGTQWILTAAHCFGNSQSPSDYEVRLGAYRLAETSPNEITAKVDRIIMHPQYDELTYFGDIALIRLTSPIDYTAYILPVCLPSASNSFTDGMECWVTGWGKTAFNVNLPFPGTLQEVMTPLINRTRCDQMYHIDSPVSASSEIIPSDQICSGYSDGGKDSCKGDSGGALVCKIQRVWYQIGIVSWGDGCAIANRPGVYTLVPAYQSWLSSYNATENTINVDNSGTTTAATTTRRATVTTASSASSSASSSPASSSPASSPASSPASSSPTSSSPASSSPTSSSPASSPASSSSTFVSPTILSTTPAPPACGSPLVSSRIVGGTDAREGAWPWQVSLRYRGSHICGGSVIGTQWILTAAHCFENSQFPSDYEVRLGTYRLAQTSPNEITYTVDRIIVNSQFDSSTLFGDIALIRLTSPITYTKYILPVCLPSTSNSFTDGMECWVTGWGTISLYVNLPYPKTLQEVMTPLINRTRCDQMYHIDSPVSASSEIIPSDQICSGYSAGGKDSCKGDSGGPLVCKLQGIWYQIGIVSWGEGCAIAKRPGVYTLVPAYYSWVIAEENTVNVDSIGTTNSLPTTTTTGTTTSTTTTTGTTTTGTTTSTTTTTGTTTTTTGTTTTTQGYNRSSPSSLNKSVHLIGACSFLLIWLIVVAEGQ
Donor tissue: