ORFeome > tnni1 – XORFeome 2.0

tnni1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis troponin I type 1 (skeletal, slow), mRNA (cDNA clone MGC:75706 IMAGE:5380675), complete cds
Gene Symbol: tnni1
Gene ID: 394556
ORF gb_acc: MG132970
ORF ID: 10346

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061268

Library Location

Plate ID: GDExt11003
Well Location: F07

EST Sequences

Clone: MGC:75706 IMAGE:5380675
Trimmed Sequence: ATGTCTGAAAGCACAGAGAGAAAATCAAAAATTCCAGCTTCCAGAAGGCTACTTCTGAAGACTCTTATGCTTCAGAAGGCGACTGAGGAGCTGGAAAAAGAGAAGAGAGAGGCAGATGAGGAGAAGACAAGGATTCTAGATGAAAAGGTTCCATCTTTGCAAATTGCTGGGCTTTCCCTCCAGCAGCTGCAGGAACTGTGCACAAAATTACACAAACAAATTGATTCAGTAGATGAGGAACGTTATGACATTGAAGTAAAAGTAAAGAAGCATGACATAGAGATTGAAGGTTTAACTCAAAAGATTTTTGACCTGAAAGGAAAATTCAAGCGGCCCAACTTGAAAAGAGTGCGTATCTCGGCAGATGCTATGCTCAAAGCCCTTCTGGGAAACACACACAAGGTTTCTGTAGATCTAAGAGCCAACCTGAAATCTGTGAGAAAGGAAGATGAGAAGGAAAAGACAGTAGAAGTTACTGATTGGCGTAAGAACATTGAAGCCATGTCTGGCATGGAGGGCAGAAAGAAGAAATTCGACACCAGCAATGCTTAA
Full Trace Sequence: gctctttcaggttgacagacgaacaaaagaataaaccatgtctgaaagcacagagagaaaatcaaaaattccagcttccagaaggctacttctgaagactcttatgcttcagaaggcgactgaggagctggaaaaagagaagagagaggcagatgaggagaagacaaggattctagatgaaaaggttccatctttgcaaattgctgggctttccctccagcagctgcaggaactgtgcacaaaattacacaaacaaattgattcagtagatgaggaacgttatgacattgaagtaaaagtaaagaagcatgacatagagattgaaggtttaactcaaaagatttttgacctgaaaggaaaattcaagcggcccaacttgaaaagagtgcgtatctcggcagatgctatgctcaaagcccttctgggaaacacacacaaggtttctgtagatctaagagccaacctgaaatctgtgagaaaggaagatgagaaggaaaagacagtagaagttactgattggcgtaagaacattgaagccatgtctggcatggagggcagaaagaagaaattcgacaccagcaatgcttaaaagccaagacctggagatggttcccgaagacttgcaacatttcatagaacttctgactattatgtaaaaatggatacaagaatacacaaagcatcataacattctgattgctgaaatatttatggttcctttaatatgtaaaaaaaatgtataatgttctttttcaaaaaccttttcacataactgagcaactacccaggtcatgggatattgcacagagggctgccatgtttcacagctggtggggaagagctcaaacctgagcagtttgtcttttggatgaattcacacaagcagagaatatgtctcatgtgccatgatccttagagatgatgctttggaagtgtaaataggtcaacatcctgagattcatcagagatttgcattctttattctaaaaaaattaaaatcactgtgaaaaacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSESTERKSKIPASRRLLLKTLMLQKATEELEKEKREADEEKTRILDEKVPSLQIAGLSLQQLQELCTKLHKQIDSVDEERYDIEVKVKKHDIEIEGLTQKIFDLKGKFKRPNLKRVRISADAMLKALLGNTHKVSVDLRANLKSVRKEDEKEKTVEVTDWRKNIEAMSGMEGRKKKFDTSNA
Donor tissue: tadpole