ORFeome > tollip – XORFeome 2.0

tollip – XORFeome 2.0

General Information

Species: Xenopus tropicalis toll interacting protein, mRNA (cDNA clone MGC:79626 IMAGE:6979937), complete cds
Gene Symbol: tollip
Gene ID: 448770
ORF gb_acc: MG133607
ORF ID: 11144

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076673

Library Location

Plate ID: GDExt11011
Well Location: H10

EST Sequences

Clone: MGC:79626 IMAGE:6979937
Trimmed Sequence: ATGGCAACGAGTATCAGCACCCAGAGAGGCCAGGTGTTTATTGGGGAACTGCCCCAAGATTTCCTGCGCATTACCCCTACCCAGCAGCAGCAGCAGATACAGTTGGATGCCCAGGCAGCACAGCAGCTACAGTATTCTGGAGTTATGGGGACCATGGGCCGACTCAGCATTACTGTGGTGCAGGCTAAGCTTGCTAAGAATTATGGAATGACCCGGATGGACCCATACTGCCGGATACGTTTGGGATATGCAGTGTATGAGACGCCTACTGCTCATAATGGGGCTAAGAACCCACGGTGGAACAAAGTGATTCAGTGCACAATTCCTCCTGGAGTTGATTCCTTCTACCTAGAAATATTTGATGAGAGAGCATTCTCAATGGATGACCGCATTGCCTGGACACACATCACTATCCCAGAGACACTGAAGGAAGGAAAGCATGTGGATGAATGGTTCAGTTTAAGTGGCAGACAAGGGGATGACAAGGAAGGAATGATCAACCTCGTCATGTCCTACACGTCCGTGCCAGCAATGATGCCTCAACAGCCTGTAGTTTTGATGCCCACCGTCTACCAGCAGGGGGTCGGCTATGTGCCCATTGCAGGTCCTATTTACAACCCTGGGATGCCAATGGCTGCTCCTCCACCAGCTGTTAACCCTCAACACCAGACTCGAGAAGAGGACATTAAATTCATTAAGGATATGTTCCCCACCATGGACCCTGAGGTCATTCGTTCTGTGCTGGAGGCGCAAGGAGGAAACCGGGATGCTGCTGTCAACTCCCTGCTTCAGATGGTGGAAGATTCATAG
Full Trace Sequence: atttgttagagggtgtagcagctaaaacaggaagtgtcttggagaagacgagaccggagagataagagctgttcagaagccatggcaacgagtatcagcacccagagaggccaggtgtttattggggaactgccccaagatttcctgcgcattacccctacccagcagcagcagcagatacagttggatgcccaggcagcacagcagctacagtattctggagttatggggaccatgggccgactcagcattactgtggtgcaggctaagcttgctaagaattatggaatgacccggatggacccatactgccggatacgtttgggatatgcagtgtatgagacgcctactgctcataatggggctaagaacccacggtggaacaaagtgattcagtgcacaattcctcctggagttgattccttctacctagaaatatttgatgagagagcattctcaatggatgaccgcattgcctggacacacatcactatcccagagacactgaaggaaggaaagcatgtggatgaatggttcagtttaagtggcagacaaggggatgacaaggaaggaatgatcaacctcgtcatgtcctacacgtccgtgccagcaatgatgcctcaacagcctgtagttttgatgcccaccgtctaccagcagggggtcggctatgtgcccattgcaggtcctatttacaaccctgggatgccaatggctgctcctccaccagctgttaaccctcaacaccagactcgagaagaggacattaaattcattaaggatatgttccccaccatggaccctgaggtcattcgttctgtgctggaggcgcaaggaggaaaccgggatgctgctgtcaactccctgcttcagatggtggaagattcatagcggccaagccctccgtacagtttccccttcccttgcctgtgtcctgtatgacttgccataaagggaatctcatcctccctaactttgatataacatatggctgctcttttacgttgagtgttgattgtggtcttctcagcttctcctaccatcttttctgaagttggaagttccctcacattcctcctgagcctgcagtgcccttattagtgttaatatatttttcagatgccatgagcacactgtaccccctatcctttatgcttgattggactgagctgttctcgttaagatgtgttctgtcgtctgtgcttccattgactctgatcactgtacctgcccattcatttggaatatcatcatgtgtctgtttttccttttaaattattaatgtaaggaaacaactataatattttaacattgcaaaaaaaaaaaaaa
Translation: MATSISTQRGQVFIGELPQDFLRITPTQQQQQIQLDAQAAQQLQYSGVMGTMGRLSITVVQAKLAKNYGMTRMDPYCRIRLGYAVYETPTAHNGAKNPRWNKVIQCTIPPGVDSFYLEIFDERAFSMDDRIAWTHITIPETLKEGKHVDEWFSLSGRQGDDKEGMINLVMSYTSVPAMMPQQPVVLMPTVYQQGVGYVPIAGPIYNPGMPMAAPPPAVNPQHQTREEDIKFIKDMFPTMDPEVIRSVLEAQGGNRDAAVNSLLQMVEDS
Donor tissue: tailbud