ORFeome > trip11 – XORFeome 2.0

trip11 – XORFeome 2.0

General Information

Species: Xenopus tropicalis thyroid hormone receptor interactor 11, mRNA (cDNA clone MGC:79667 IMAGE:6980466), complete cds
Gene Symbol: trip11
Gene ID: 448517
ORF gb_acc: MG133693
ORF ID: 11248

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC076681

Library Location

Plate ID: GDExt11012
Well Location: F06

EST Sequences

Clone: MGC:79667 IMAGE:6980466
Trimmed Sequence: ATGGCGTCCTGGTTTGGGGGCTTGAGCTCTGGTATTGGCCAGTCACTGGGACAGGTTGGGGGTAGCTTGTCATCCATCACTGGACAGATTTCAAACTTCACAAAGGATATGCTACTGGAAGGAGCCGAGGAGGTGGGAGATGTTAATACTGAGCTTCAAGTTTCCAACTCAAAGCTGAGAGACATAGAGAATGTTCAAACCATGCAGAGATCAGAGAATGAAAGGCTGAGGAAGCTTTGTACTGAACTCGAGGAGAAACACGAAACAGCTGAGCTCCAGGTTAAACAGCAGTCCCTAGATTTCAGGAATCGTCTGCAGCAAAAAGAGGTGGAAGTAAGCCATCTCAAAGCAAAGCTTAATGCCCTCCAGGAACAAATGCAGAAAATGCAGGCATCAGCTCAACTTGCTGGGGTCACCCTTCAGACCATCAACACATCATCTTTTATGCCTACTTCCCAAACACCTGTTTCAGCATTTCAAGGGGATGACATGGATTTTGGTGATGTGATTTGGTCCCAACAAGAGATAAACAGATTATCAAGTGAAGTCTCCCGGCTGGAAAGTGAATTGGCCCATTGGAAACAGATTGCTCAGGCACCAAAAAGCCAAGGAACACAAAAGACTGACACAAATGAGATCTGTGTATTGCAAAATGTTATTAAGGAGCTGAAGCAGAAGCTGAGTCATGAAATAGATGAGCATCAACATGAGCTGTCAGTGCTACAAGATGCACATCGGCAAAAGCTGACAGAGATCACCCGACGACACCGAGAGGAATTAGGGGAGTATGAAGAGAGGATTGAAGAATTGGAGGAACAGTTACAGCCAGGTATCCTTCCTCATCATTGA
Full Trace Sequence: ctgccgtcgtgttggcggagtctgtgttggtttggagttcatgagagattcgggcgacaaggcgaacgctggtgctatcatgagccaaggaacattaatatctgtactgttaccttagagctttccgagtaaagtgaccggattattaacgtcatctgtaaaaagaagtctccaattacacatttattacagggttccaataccttttacttgtccattatactgtcagtctctgagccatggcgtcctggtttgggggcttgagctctggtattggccagtcactgggacaggttgggggtagcttgtcatccatcactggacagatttcaaacttcacaaaggatatgctactggaaggagccgaggaggtgggagatgttaatactgagcttcaagtttccaactcaaagctgagagacatagagaatgttcaaaccatgcagagatcagagaatgaaaggctgaggaagctttgtactgaactcgaggagaaacacgaaacagctgagctccaggttaaacagcagtccctagatttcaggaatcgtctgcagcaaaaagaggtggaagtaagccatctcaaagcaaagcttaatgccctccaggaacaaatgcagaaaatgcaggcatcagctcaacttgctggggtcacccttcagaccatcaacacatcatcttttatgcctacttcccaaacacctgtttcagcatttcaaggggatgacatggattttggtgatgtgatttggtcccaacaagagataaacagattatcaagtgaagtctcccggctggaaagtgaattggcccattggaaacagattgctcaggcaccaaaaagccaaggaacacaaaagactgacacaaatgagatctgtgtattgcaaaatgttattaaggagctgaagcagaagctgagtcatgaaatagatgagcatcaacatgagctgtcagtgctacaagatgcacatcggcaaaagctgacagagatcacccgacgacaccgagaggaattaggggagtatgaagagaggattgaagaattggaggaacagttacagccaggtatccttcctcatcattgattttttttaagattaaacaacaatttttgaaattgcaccaaatgcaggggcagtacccttagttcaataaatttttaaaaaccttaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MASWFGGLSSGIGQSLGQVGGSLSSITGQISNFTKDMLLEGAEEVGDVNTELQVSNSKLRDIENVQTMQRSENERLRKLCTELEEKHETAELQVKQQSLDFRNRLQQKEVEVSHLKAKLNALQEQMQKMQASAQLAGVTLQTINTSSFMPTSQTPVSAFQGDDMDFGDVIWSQQEINRLSSEVSRLESELAHWKQIAQAPKSQGTQKTDTNEICVLQNVIKELKQKLSHEIDEHQHELSVLQDAHRQKLTEITRRHREELGEYEERIEELEEQLQPGILPHH
Donor tissue: tailbud