ORFeome > tsg101 – XORFeome 2.0

tsg101 – XORFeome 2.0

General Information

Species: Xenopus tropicalis tumor susceptibility gene 101, mRNA (cDNA clone MGC:76193 IMAGE:5335933), complete cds
Gene Symbol: tsg101
Gene ID: 394879
ORF gb_acc: MG132813
ORF ID: 10158

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064236

Library Location

Plate ID: GDExt11002
Well Location: C03

EST Sequences

Clone: MGC:76193 IMAGE:5335933
Trimmed Sequence: ATGGCGCTGTCTGAGGCCCAGCTCAAGAAACTGCTCGGGAAGTACAAATACAGGGACCTCTCAGTGCGGGAAATTCTCAATGTCACCTCCCTGTACAGAGACCTCAAGCCCATCATGGACTCCTACGTGTTCAACGATGGCTCCTCCCGGGAGTTGCTGAGTCTGTCCGGTACCATTCCTGTGCCCTATAAAGGGAACACATACAACATCCCAATCTGCCTGTGGCTCCTGGACACCTACCCCTTCAACCCCCCCATCTGTTTTGTCAAGCCCACCAGTACGATGACCATCAAAACAGGAAAACACGTTGACGCCAACGGCAAAATCTATCTCCCGTATCTGCACGAGTGGAAACACCCGCCGTCTGATTTGCTGGGACTCATCCAAATCCTCATTGTTGTTTTCGGAGAAGAGCCTCCAGTTTTCTCCCGCTCTACTGCTCCTGCCCCGTACCCCATGTACCCAGCAACAGGACCCCCAAACAGTTCCTACATGCCCGGGGTGATTCCCCCCTACCCACCCGCTGCACATCCGGCCAATCCCAGTGGCTACGGAGGGTTCCCAGGGTACCCACCCGCCGGGCAGTACCCCCAGACGTCCGGCCCCCAGATCTTCCCTCAGCCCCCGGCTGCACAGCCCCCCGTCACTAGTTCTGGCCCCGCCAGGGACGGCACCATTGGGGAGGACACAATCCGCGCGTCTCTCATATCGGCGGTCAGTGACAAACTGAGATGGAGGATGAAGGAGGAGATGGACCGGGCCCAGGCCGAGCTCAACGCCCTGAAGCGCACGGAGGAAGACCTGAAGAAGGGCCACCAGAAGCTGGAGGAGATGGTCACTCGTCTGGAACAGGAAGTGACGGAGGTGGATAAGAACATTGAGACCCTGAGGAAGAAGGACGAGGAGCTGGGGGTGGTGGTGGAGAAGATGGAGAGTCAGTCCGAGTACCGAGACATCGATGAAGTGATCGTCCCCACCGCTCCCCTCTATAAACAGATCCTCAATCTCTACGCCGAGGAGAACGCCATCGAGGACACCATCTTCTACCTGGGGGAGGCGCTCCGGCGCGGCGTCATCGACCTCGATGTTTTCCTTAAGCACGTCCGGCTCCTGTCCCGCAAGCAGTTCCAGCTCCGCGCCCTCATGCAGAAGGCCAGGAAGACGGCGGGATTGAGCGATCTGTATTGA
Full Trace Sequence: tcagaacttccgggaaagtccaaacaggtagtgggagagtcgggctgtaccatggcgctgtctgaggcccagctcaagaaactgctcgggaagtacaaatacagggacctctcagtgcgggaaattctcaatgtcacctccctgtacagagacctcaagcccatcatggactcctacgtgttcaacgatggctcctcccgggagttgctgagtctgtccggtaccattcctgtgccctataaagggaacacatacaacatcccaatctgcctgtggctcctggacacctaccccttcaacccccccatctgttttgtcaagcccaccagtacgatgaccatcaaaacaggaaaacacgttgacgccaacggcaaaatctatctcccgtatctgcacgagtggaaacacccgccgtctgatttgctgggactcatccaaatcctcattgttgttttcggagaagagcctccagttttctcccgctctactgctcctgccccgtaccccatgtacccagcaacaggacccccaaacagttcctacatgcccggggtgattcccccctacccacccgctgcacatccggccaatcccagtggctacggagggttcccagggtacccacccgccgggcagtacccccagacgtccggcccccagatcttccctcagcccccggctgcacagccccccgtcactagttctggccccgccagggacggcaccattggggaggacacaatccgcgcgtctctcatatcggcggtcagtgacaaactgagatggaggatgaaggaggagatggaccgggcccaggccgagctcaacgccctgaagcgcacggaggaagacctgaagaagggccaccagaagctggaggagatggtcactcgtctggaacaggaagtgacggaggtggataagaacattgagaccctgaggaagaaggacgaggagctgggggtggtggtggagaagatggagagtcagtccgagtaccgagacatcgatgaagtgatcgtccccaccgctcccctctataaacagatcctcaatctctacgccgaggagaacgccatcgaggacaccatcttctacctgggggaggcgctccggcgcggcgtcatcgacctcgatgttttccttaagcacgtccggctcctgtcccgcaagcagttccagctccgcgccctcatgcagaaggccaggaagacggcgggattgagcgatctgtattgaagccccgccccttccctttctcctccccagactcttccttcaaacattagaaatgggggttaacttattcctagagacccagttggggcagctcatcttgtttggtgccctggggggctgaggactgatggtaccgccccagcggactaacattacgccagtgggtggggctcccttccgatcttgttcttcaccagcagtaggtgggctctgtgtgggaacagagggaatgctgggaattctgtgccatgggtgggaggagccactcgtagcaccaaatcccctgtatgctaatcagctgattaatattcgaattaaatggctactgattcgttctgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MALSEAQLKKLLGKYKYRDLSVREILNVTSLYRDLKPIMDSYVFNDGSSRELLSLSGTIPVPYKGNTYNIPICLWLLDTYPFNPPICFVKPTSTMTIKTGKHVDANGKIYLPYLHEWKHPPSDLLGLIQILIVVFGEEPPVFSRSTAPAPYPMYPATGPPNSSYMPGVIPPYPPAAHPANPSGYGGFPGYPPAGQYPQTSGPQIFPQPPAAQPPVTSSGPARDGTIGEDTIRASLISAVSDKLRWRMKEEMDRAQAELNALKRTEEDLKKGHQKLEEMVTRLEQEVTEVDKNIETLRKKDEELGVVVEKMESQSEYRDIDEVIVPTAPLYKQILNLYAEENAIEDTIFYLGEALRRGVIDLDVFLKHVRLLSRKQFQLRALMQKARKTAGLSDLY
Donor tissue: tailbud