ORFeome > ttyh2 – XORFeome 2.0

ttyh2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis tweety homolog 2, mRNA (cDNA clone MGC:76161 IMAGE:5335415), complete cds
Gene Symbol: ttyh2
Gene ID: 395050
ORF gb_acc: MG132717
ORF ID: 10011

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC064869

Library Location

Plate ID: GDExt11001
Well Location: B03

EST Sequences

Clone: MGC:76161 IMAGE:5335415
Trimmed Sequence: ATGGCAGCGGCTCGGGTGGAATATATCGCTCCATGGTGGGTTTATTGGCTGCACAATTTCCCGCATGTAGACCTTTCGTTGCGGCAGAAGAGCCCCGATTTTAACCCCAAGGACCCCGGGTATCAGCAGACATTGCTATTTGTTGCATTGATCGTTGCCCTCTGTGCTGCTGTCAACCTGCTGTTTGTCTCGGTCTATCTTATATGCCTTTGCTGTTGCAAGAAAGAAGATGAAACGGAGACAAAGAAGACAAGTTCCTGCTGTGTCACCTGGACTGCTGCTGTGTCTGGCCTTCTCTGCTGTGCTGCAGTTGGCATTGGTTTCTATGGGAACAGTGAGACCAATGATGGGGTTTACCAGCTGACCTACTCCTTGGATAATGCCAACCACACTCTGGCTGGGATTGATTCTCTGGTGTCAAACACCAATTTCAAGATGAAGGAAGATCTTGATAAGCACTTGTTTCGCCTAAATGAGATATTTGCAGCGAGGGGAGATTATGTCCAGAGCCTTAGATTCATGCAGCAGATGGCTGGTAACATCATCCAGCAGCTCACCAGCTTGCCCAACTGGCAGGGAACCAGTGTGAATCTCTCAGACATTGCAAGGCAGACCAGCACCATTGAGTATTACAGGTGGCTCTCCTACCTCCTCCTTTTCATCTCTTACGTTGTTATCTGCCTCGTCACTTGCGTTGGACTGGCCAAAAAATCAAAGTGTCTGCTTCTAATAATGCTGTGCTTTGGGCTAATTGCTCTCATGCTAAGTTGGACATCCCTGGCCCTGGAAACCTCCTCCGCAATGGGCACCAGTGATTTCTGTGTGGCTCCAGACAAATTCATCATGAACATGACCCATGATCAGATCACAACAGAAGTTGTCCATTACTATTTGTACTGCAGCCAGAGTCTGAGAAACCCTTTTCAGCAGGCTCTGACAGTCTTCCAAAGGTCGCTCACAACTATGCAAATCCAGGTTCAAGGCTTACTGCAGTTTGCTGTGCCATTATTTCCCACAGCCCAGAAGGACTTGTTGGGTATACAGCTACTTCTAAACACTTCTGAATCCAACCTTCATCAGATTACAGCTCTGCTGGATTGCAGAGGACTACACAAGGACTATCTGGAGGCTCTGATTGGCATCTGCTATGATGGAGTAGAAGGAATGCTGTATCTAGGTCTGTTCTCACTGCTGGCAGCGTTGGCGTTTACTGCCATGGTGTGTGCAATGCCACAAGCCTGGAAACACTTGGAAGCTCGGGACAGAGATTATAACGACATTGATGATGAGGACCCCTTCAACCCACAAGCTCGCAGAATAGCAGCGCACAATCCAAACCGGGGGCAGCTAAGGAGTTTCTGCAGCTACAGCAGTAGCATGGGTAGCCAGGCCAGCCTCCAGCCTCCCGCACCGACTGTCTCCAATGCCCCTGTGGCTGAATATATGAACCAGGCAGCTCTGTTCGGAGGAAACCCTCGCTATGAGAACGTTCCGCTGATAGGGAGAGGATCCCCTCCACCCACGTATTCTCCAACTATGAGGGCCACATATCTCTCAATGACCGAGGAGCCTTCCAGTATATACAGCAATGTGTTTCCAGCCTAG
Full Trace Sequence: cgcttaccgggcagtaatacacgggggggaatggcagcggctcgggtggaatatatcgctccatggtgggtttattggctgcacaatttcccgcatgtagacctttcgttgcggcagaagagccccgattttaaccccaaggaccccgggtatcagcagacattgctatttgttgcattgatcgttgccctctgtgctgctgtcaacctgctgtttgtctcggtctatcttatatgcctttgctgttgcaagaaagaagatgaaacggagacaaagaagacaagttcctgctgtgtcacctggactgctgctgtgtctggccttctctgctgtgctgcagttggcattggtttctatgggaacagtgagaccaatgatggggtttaccagctgacctactccttggataatgccaaccacactctggctgggattgattctctggtgtcaaacaccaatttcaagatgaaggaagatcttgataagcacttgtttcgcctaaatgagatatttgcagcgaggggagattatgtccagagccttagattcatgcagcagatggctggtaacatcatccagcagctcaccagcttgcccaactggcagggaaccagtgtgaatctctcagacattgcaaggcagaccagcaccattgagtattacaggtggctctcctacctcctccttttcatctcttacgttgttatctgcctcgtcacttgcgttggactggccaaaaaatcaaagtgtctgcttctaataatgctgtgctttgggctaattgctctcatgctaagttggacatccctggccctggaaacctcctccgcaatgggcaccagtgatttctgtgtggctccagacaaattcatcatgaacatgacccatgatcagatcacaacagaagttgtccattactatttgtactgcagccagagtctgagaaacccttttcagcaggctctgacagtcttccaaaggtcgctcacaactatgcaaatccaggttcaaggcttactgcagtttgctgtgccattatttcccacagcccagaaggacttgttgggtatacagctacttctaaacacttctgaatccaaccttcatcagattacagctctgctggattgcagaggactacacaaggactatctggaggctctgattggcatctgctatgatggagtagaaggaatgctgtatctaggtctgttctcactgctggcagcgttggcgtttactgccatggtgtgtgcaatgccacaagcctggaaacacttggaagctcgggacagagattataacgacattgatgatgaggaccccttcaacccacaagctcgcagaatagcagcgcacaatccaaaccgggggcagctaaggagtttctgcagctacagcagtagcatgggtagccaggccagcctccagcctcccgcaccgactgtctccaatgcccctgtggctgaatatatgaaccaggcagctctgttcggaggaaaccctcgctatgagaacgttccgctgatagggagaggatcccctccacccacgtattctccaactatgagggccacatatctctcaatgaccgaggagccttccagtatatacagcaatgtgtttccagcctagtccccccagggtgccatcctctgctcaatacactgggtgacatggttaattctgggcccgcactgccagtgggttttcctaaaagacaaagggatgtttactacaaacatctaattatagaactggggcatccactgaggggcaagtcttccaaccagggtggattttcagcgcaacaacaaagatggtgtgccgacgctaccagttcttggatgtatcatgtttgccaagatctaggcggataagtctcaggcggatactgggggggtttgtctctttgcttcctctgggattcacagtgttttaaaatcctacagaatatcaggttgacattgtgacaacaacagacactgcctttcttaaacccagactacaatgtaaaatgttatcttcttggaccaatgttaatattgacatgtacagcatcttgcaggtaatacgcaagaaaccttcacttctatttcccttgggcacatgttttctcaatatccaaagtacattataagccttcggataaaacagatgaaccaactgctcaggggttgtattaggaaccaccctagtaccatggaatggtaggaccctgtctctatactaagtgctagcctttctggtttagaatgggccagaaatgtagaaagtgatgtttaaccttcattgttcagccttttatatgcaaacgtctatctaataattcttatgattatgttcaaggtcctgtccaacaaggataatctttttaaggggttctgagtttatgaaatgaaacttaatatacatcaatgtttgccaaattgtatataacttaagtctagggccagaatgtaaagctatccctgagtacaggtcacaaatatatcaacagatgtgctcccagggtaggaaaactccacatgttcatgaacatacagccccttacacctgtcactgggatgggatttctgcaacagcacaactacatataagctctgtaccagcccaagtactggaggcacactcaattctcttctctggattcagaaccaaaatttgttaaaaagcaactcattcacagcttacagacagcatgcaggaactacgtaacccacaatgcattgcactgtgatgttcctttccttaatgacatcacgtgcagggaattatgggattgggaggatgcaggctgaaggcaggctgaggactgtcaactacttttacattttatttgagtctcaaagtagtcagccagatcagcaggggaacagggggcggggcttaggggactgttccaaaccatattattacattaaaaggctgcatatttttaattaatgtataatgcaaagttgattgaaattatgtttacttttcgaaacgattaagttgtgttttggtggagttccctttcaatgggactaatgtaattaaaacaatgttacattgccacatactctttaaaggagaactaaacccatattgtaagcatagggtctgtgcacagtaccttccccccaaactacaacaatcagactcctcagaatggccccgtccccctgtacctgaccttctaatgtgatttgctcagtggctttggcaagcgtcaggtatagggaagggccattctgaagagcctgcttgtggggtagctcctgtgcaagggccctgtgcttacaatatggctgtaggtgggctgggtgccaaatcatcagctaattctgggctactcatttggtggaacattgtgcattaatatagaattgtgcagtttctccagtgaatgctggtctgtagctatttcctgttgcaccctggccctgtagcaaactgggaaggacacatctccccccacttcctgtagtgatattatttagctatctacaggtacagaccatattgtttcagtcattccaaccacaggtccaactgctgaaggctgagtatttccagttattgtaaataaaaaactagtgattaatcggccaaactctcagggaagcttggagagattcctgccccaggctaagggtaacagagtatgggcatgtacttgcccctgtcacgatgccccttgtgccattacccgaatttcttctttgggcaagtcagcctgtaaggggcccagaatcatctaacatattgtcctcactattgttaaaccagttggcaaaaaactacggacatttaatgacagaacagaagctcctatgagcatctccctttgtagcatttacagtttgtatttgtatgtaactcctccttctgcgctaatgaataggctaagcgctttataaataaatactaatgaatatatatatgcctgatatttgatatatgatgtattatttatcaaatgtgtcctttgcaaatatacatattcctttcaagatggctgctgttagttttggctcctcagactcctactgagctcacagcttgccataagcccttcctactttacccagacacccataatcacacactcccatagtcacacacacccccatagtcacacacacccccatagtcacgcccccatagtcacacaccctcatagtcacccccccatagtcacacaccccatagtcatgccccccatagtcacacaccccatagtcatgccccccatagtcacacacccccatagtcacccccccatagtcacacaccccatagtcatgcccccccacacactgcctgggggcccaaaggggtgtcacctaaaaggacaggcaccctacctccattctttttaatacagaacgctttgtcgtataataaaacacaaaatactattctgaaaaaaaaaaaaaaaaaaaa
Translation: MAAARVEYIAPWWVYWLHNFPHVDLSLRQKSPDFNPKDPGYQQTLLFVALIVALCAAVNLLFVSVYLICLCCCKKEDETETKKTSSCCVTWTAAVSGLLCCAAVGIGFYGNSETNDGVYQLTYSLDNANHTLAGIDSLVSNTNFKMKEDLDKHLFRLNEIFAARGDYVQSLRFMQQMAGNIIQQLTSLPNWQGTSVNLSDIARQTSTIEYYRWLSYLLLFISYVVICLVTCVGLAKKSKCLLLIMLCFGLIALMLSWTSLALETSSAMGTSDFCVAPDKFIMNMTHDQITTEVVHYYLYCSQSLRNPFQQALTVFQRSLTTMQIQVQGLLQFAVPLFPTAQKDLLGIQLLLNTSESNLHQITALLDCRGLHKDYLEALIGICYDGVEGMLYLGLFSLLAALAFTAMVCAMPQAWKHLEARDRDYNDIDDEDPFNPQARRIAAHNPNRGQLRSFCSYSSSMGSQASLQPPAPTVSNAPVAEYMNQAALFGGNPRYENVPLIGRGSPPPTYSPTMRATYLSMTEEPSSIYSNVFPA
Donor tissue: tailbud