ORFeome > tub – XORFeome 2.0

tub – XORFeome 2.0

General Information

Species: Xenopus tropicalis tubby homolog, mRNA (cDNA clone MGC:79522 IMAGE:6977645), complete cds
Gene Symbol: tub
Gene ID: 493219
ORF gb_acc: MG133551
ORF ID: 11081

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC079929

Library Location

Plate ID: GDExt11010
Well Location: H08

EST Sequences

Clone: MGC:79522 IMAGE:6977645
Trimmed Sequence: ATGACTTCTAAGCACCAGTCAGACTGGATCCCTTACAGTGTTTTAGATGATGAGAGCAGCAGTTTGCGGCAACAGAAGCTCGACAGGCAGCGGGCATTATTGGAACAGAAACAGAAGAAGAAGCGCCAGGAGCCTCTCATGGTCCAATCAAACGTAGACAGTCGGGCGCGCGGGCGCAGGATGAAGCAGTCGGAGGAACAAGCGCCCCTAGTGGAATCCTATAACAGCAGCAACAGCAGCACAATCTACCATGGCATCGATGGTCCGGCCGCTTTTCAAGATGAAGCTTCGAGCCCCGGGAGCCAAGTCCAGATTCTGACGGTGGGGCAGTCGGGCCATGAAGAGGAGGCTACGGAGACCGCGGCCAGTGGCCAACAGCAGGGCAAACAGGACCTGCGGATCACCATGCAGAAAAAGGGGATATCGAGCAGCATGAACTTTGATGAGGAGGAGGATGAAGAAGATGAAGACAGTTCAAGTTCTTCTCAGCTGAACAGCAGCACTCGGCCCGGGTCGGCCACGAGCAAGAAATCCAGTAAGGAGACAGTGTCGGCTCCCAGCCCCCCCTCCAATGAACCCTCCATCGATGTAGAAGACCTGGAGGAATTCTCTATGCGGCCGGCCCCACAGGGAGTGACGATCAAATGCAGAATCACGAGGGACAAGAAGGGGATGGACAGAGGGATGTACCCCACTTATTACCTCCATCTGGAACGGGAGGACGGCAAAAAGGTTTTCCTATTGGCCGGCAGGAAGCGAAAGAAAAGCAAAACTTCCAATTACCTCATTTCCATTGACCCGACGGACCTTTCCCGCGGGGGGGAGAGCTTTATTGGCAAACTCAGATCAAACCTGATGGGCACAAAGTTTACCGTTTACGATAACGGGGTGAATCCGGGCAAAACCACCTCGAGTTTGGAGGCCAGTAACCTGCGCCAGGAGCTCGCCGCCATCTGCTACGAGACAAACGTCTTAGGGTTCAAAGGGCCCCGGAAGATGAGTGTGATTATTCCCGGGATGAATATGGATCATGAGCGAGTGTCTATCCGGCCCCGGAACGAACACGAGACGCTGCTCTCTCGGTGGCAGAACAAGAACACGGAGAGCGTCATCGAGCTGCACAACAAGACCCCCGTGTGGAACGACGACACCCAATCGTACGTGCTGAACTTCCACGGGCGGGTCACGCAGGCGTCCGTCAAGAATTTCCAAATCATACACGACAATGACCCGGATTATATCGTGATGCAGTTCGGCCGCGTGGCGGAGGATGTGTTTACAATGGACTATAACTACCCCATGTGTGCGTTACAAGCATTCGCCATAGCCCTGTCCAGCTTCGATAGCAAACTGGCCTGCGAGTGA
Full Trace Sequence: gtctgcacggggtctaaacaggttcacttcttgtctgcggctccttcctactgaggcgcaacctcggcttttggggaacgatgacttctaagcaccagtcagactggatcccttacagtgttttagatgatgagagcagcagtttgcggcaacagaagctcgacaggcagcgggcattattggaacagaaacagaagaagaagcgccaggagcctctcatggtccaatcaaacgtagacagtcgggcgcgcgggcgcaggatgaagcagtcggaggaacaagcgcccctagtggaatcctataacagcagcaacagcagcacaatctaccatggcatcgatggtccggccgcttttcaagatgaagcttcgagccccgggagccaagtccagattctgacggtggggcagtcgggccatgaagaggaggctacggagaccgcggccagtggccaacagcagggcaaacaggacctgcggatcaccatgcagaaaaaggggatatcgagcagcatgaactttgatgaggaggaggatgaagaagatgaagacagttcaagttcttctcagctgaacagcagcactcggcccgggtcggccacgagcaagaaatccagtaaggagacagtgtcggctcccagccccccctccaatgaaccctccatcgatgtagaagacctggaggaattctctatgcggccggccccacagggagtgacgatcaaatgcagaatcacgagggacaagaaggggatggacagagggatgtaccccacttattacctccatctggaacgggaggacggcaaaaaggttttcctattggccggcaggaagcgaaagaaaagcaaaacttccaattacctcatttccattgacccgacggacctttcccgcgggggggagagctttattggcaaactcagatcaaacctgatgggcacaaagtttaccgtttacgataacggggtgaatccgggcaaaaccacctcgagtttggaggccagtaacctgcgccaggagctcgccgccatctgctacgagacaaacgtcttagggttcaaagggccccggaagatgagtgtgattattcccgggatgaatatggatcatgagcgagtgtctatccggccccggaacgaacacgagacgctgctctctcggtggcagaacaagaacacggagagcgtcatcgagctgcacaacaagacccccgtgtggaacgacgacacccaatcgtacgtgctgaacttccacgggcgggtcacgcaggcgtccgtcaagaatttccaaatcatacacgacaatgacccggattatatcgtgatgcagttcggccgcgtggcggaggatgtgtttacaatggactataactaccccatgtgtgcgttacaagcattcgccatagccctgtccagcttcgatagcaaactggcctgcgagtgagggcacggacccagccaatcaccaagaacattttgttttggggtgtgggggggggcggggttcttattcagtcaagccccgccccttactttctatgttcttcgccatgttctttttttccccccctccaatgaaccaatccctcgctgtgggcggagactgcactttcacccacacgtggtggggattccgcttctttctgcaaaggtggaaattgcaattttatttttgtaattatttttatggagggggggggcggggaagagatgttttcaagactctgaagcgggttggacccccagggggcgctgttactgatcccattaaccttagtgtttcttttgtacccaagtgcatgaactgttttgccttctcacccagcgaatatgaaccaatggggcggccaatccttagtgctgacagattgggggtcgactaaactaaaatgctgagcaaaagcacaaggcgccttcgtgtttctgtgccgggattcactttatggcacttttgtggtcggaaggatctgcccttttcggcgaatccgtcacccccattttttttttctatctcatattgtagttattaacccccaccagtcattgcagatattgtggtccacgtactgtatcctaatttttagctgtaactaaacccatggttaacccttcggtatgggggggaggggcctcgtccgacattgtgaggcttattcccttcccctcgttcttttttttttttaatgataaagtgtctttcacatctgtgcgagggtgatgggtatcttagaaccgttctgtatattaaatttgtctggacttgagtgtctaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTSKHQSDWIPYSVLDDESSSLRQQKLDRQRALLEQKQKKKRQEPLMVQSNVDSRARGRRMKQSEEQAPLVESYNSSNSSTIYHGIDGPAAFQDEASSPGSQVQILTVGQSGHEEEATETAASGQQQGKQDLRITMQKKGISSSMNFDEEEDEEDEDSSSSSQLNSSTRPGSATSKKSSKETVSAPSPPSNEPSIDVEDLEEFSMRPAPQGVTIKCRITRDKKGMDRGMYPTYYLHLEREDGKKVFLLAGRKRKKSKTSNYLISIDPTDLSRGGESFIGKLRSNLMGTKFTVYDNGVNPGKTTSSLEASNLRQELAAICYETNVLGFKGPRKMSVIIPGMNMDHERVSIRPRNEHETLLSRWQNKNTESVIELHNKTPVWNDDTQSYVLNFHGRVTQASVKNFQIIHDNDPDYIVMQFGRVAEDVFTMDYNYPMCALQAFAIALSSFDSKLACE
Donor tissue: tailbud