ORFeome > tuba1c – XORFeome 2.0

tuba1c – XORFeome 2.0

General Information

Species: Xenopus tropicalis tubulin, alpha 1c, mRNA (cDNA clone MGC:75684 IMAGE:5380199), complete cds
Gene Symbol: tuba1c
Gene ID: 394675
ORF gb_acc: MG132881
ORF ID: 10244

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC061260

Library Location

Plate ID: GDExt11003
Well Location: G01

EST Sequences

Clone: MGC:75684 IMAGE:5380199
Trimmed Sequence: ATGCGTGAGTGCATCTCTATACACGTTGGCCAGGCTGGTGTGCAGATCGGCAATGCCTGCTGGGAACTGTATTGTTTGGAACATGGCATCCAACCTGATGGGCAGATGCCCAGTGACAAGACCATTGGAGGAGGAGACGACTCCTTCAACACCTTTTTCAGTGAAACTGGAGCAGGAAAGCATGTCCCCAGGGCTGTCTTTGTAGACTTGGAACCCACTGTCATTGATGAGGTGCGCACTGGCACATATAGGCAGTTATTCCACCCAGAGCAGTTAATTACAGGAAAGGAAGATGCTGCCAATAATTATGCCCGGGGGCACTACACAATTGGCAAGGAGATCATTGATCTGGTGCTAGACAGGATTCGCAAACTGGCTGACCAGTGCACAGGTCTCCAGGGTTTCCTGGTCTTCCACAGCTTTGGTGGTGGTACTGGTTCTGGATTCACCTCCCTGCTGATGGAGCGTCTCTCTGTTGATTATGGAAAGAAGTCTAAGCTAGAATTTGCCATCTATCCAGCTCCTCAGGTCTCCACAGCTGTGGTTGAGCCCTACAACTCTATTCTCACAACCCACACCACCCTGGAGCACTCTGACTGTGCTTTCATGGTAGACAATGAGGCCATTTATGACATCTGCCGCAGGAATCTAGATATTGAACGCCCATCCTACACCAACCTGAACAGGCTCATTAGTCAGATAGTGTCTTCTATCACAGCCTCTCTGAGGTTTGATGGAGCCCTCAATGTAGATCTCACAGAGTTTCAGACCAACTTGGTGCCCTATCCCCGTATTCACTTCCCTCTTGCCACCTATGCCCCTGTCATCTCTGCAGAGAAGGCTTATCATGAGCAGCTTACTGTAGCTGACATTACAAATGCCTGCTTTGAACCAGCTAACCAGATGGTGAAATGTGATCCACGCCACGGTAAATACATGGCTTGTTGCCTGTTGTACCGTGGTGATGTGGTACCCAAAGATGTAAATGCAGCTATTGCCACCATCAAGACAAAGCGTACCATCCAGTTTGTGGATTGGTGCCCAACTGGTTTCAAAGTTGGTATCAACTATCAGCCCCCAACTGTGGTTCCAGGGGGAGACCTGGCCAAGGTGCAGCGTGCTGTGTGTATGCTGAGCAATACCACTGCGATTGCTGAGGCCTGGGCTCGTCTGGACCACAAGTTTGATCTCATGTATGCCAAGCGTGCCTTCGTGCACTGGTATGTGGGTGAGGGTATGGAGGAGGGTGAGTTCTCTGAGGCCCGTGAAGACATGGCTGCCCTGGAGAAAGATTATGAAGAGGTTGGTGCAGATAGTGCAGATGCAGAAGATGAAGGCGAAGAGTATTAA
Full Trace Sequence: cttaccgagactccttgctgtcggtcggtgagaagccgcaagctgtgctttcccattccgtaaaactatctgctgtctaacagaccccatccgagtcagtcatgcgtgagtgcatctctatacacgttggccaggctggtgtgcagatcggcaatgcctgctgggaactgtattgtttggaacatggcatccaacctgatgggcagatgcccagtgacaagaccattggaggaggagacgactccttcaacacctttttcagtgaaactggagcaggaaagcatgtccccagggctgtctttgtagacttggaacccactgtcattgatgaggtgcgcactggcacatataggcagttattccacccagagcagttaattacaggaaaggaagatgctgccaataattatgcccgggggcactacacaattggcaaggagatcattgatctggtgctagacaggattcgcaaactggctgaccagtgcacaggtctccagggtttcctggtcttccacagctttggtggtggtactggttctggattcacctccctgctgatggagcgtctctctgttgattatggaaagaagtctaagctagaatttgccatctatccagctcctcaggtctccacagctgtggttgagccctacaactctattctcacaacccacaccaccctggagcactctgactgtgctttcatggtagacaatgaggccatttatgacatctgccgcaggaatctagatattgaacgcccatcctacaccaacctgaacaggctcattagtcagatagtgtcttctatcacagcctctctgaggtttgatggagccctcaatgtagatctcacagagtttcagaccaacttggtgccctatccccgtattcacttccctcttgccacctatgcccctgtcatctctgcagagaaggcttatcatgagcagcttactgtagctgacattacaaatgcctgctttgaaccagctaaccagatggtgaaatgtgatccacgccacggtaaatacatggcttgttgcctgttgtaccgtggtgatgtggtacccaaagatgtaaatgcagctattgccaccatcaagacaaagcgtaccatccagtttgtggattggtgcccaactggtttcaaagttggtatcaactatcagcccccaactgtggttccagggggagacctggccaaggtgcagcgtgctgtgtgtatgctgagcaataccactgcgattgctgaggcctgggctcgtctggaccacaagtttgatctcatgtatgccaagcgtgccttcgtgcactggtatgtgggtgagggtatggaggagggtgagttctctgaggcccgtgaagacatggctgccctggagaaagattatgaagaggttggtgcagatagtgcagatgcagaagatgaaggcgaagagtattaaactttattctgttttcctcaagttgtgcctttctattcctgaatttccccttctgaagtctaacttttttttttaaaataaagcgccattttaaatgtggctttaaagtgtgaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MRECISIHVGQAGVQIGNACWELYCLEHGIQPDGQMPSDKTIGGGDDSFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGTYRQLFHPEQLITGKEDAANNYARGHYTIGKEIIDLVLDRIRKLADQCTGLQGFLVFHSFGGGTGSGFTSLLMERLSVDYGKKSKLEFAIYPAPQVSTAVVEPYNSILTTHTTLEHSDCAFMVDNEAIYDICRRNLDIERPSYTNLNRLISQIVSSITASLRFDGALNVDLTEFQTNLVPYPRIHFPLATYAPVISAEKAYHEQLTVADITNACFEPANQMVKCDPRHGKYMACCLLYRGDVVPKDVNAAIATIKTKRTIQFVDWCPTGFKVGINYQPPTVVPGGDLAKVQRAVCMLSNTTAIAEAWARLDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDMAALEKDYEEVGADSADAEDEGEEY
Donor tissue: tadpole