ORFeome > tubb6 – XORFeome 2.0

tubb6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis tubulin, beta 6, mRNA (cDNA clone MGC:79632 IMAGE:6980006), complete cds
Gene Symbol: tubb6
Gene ID: 493418
ORF gb_acc: MG133609
ORF ID: 11146

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC080942

Library Location

Plate ID: GDExt11012
Well Location: A01

EST Sequences

Clone: MGC:79632 IMAGE:6980006
Trimmed Sequence: ATGAGGGAAATTGTGCATATCCAAGCAGGACAGTGCGGGAACCAGATCGGAACCAAGTTTTGGGAAGTGATCAGTGACGAGCATGGAATTGATCCAGCAGGAGGATATGTTGGTGACTCGGCTCTGCAGCTTGAGAGGATTAACGTGTACTACAATGAATCATCTTCTCAGAAGTATGTGCCCAGGGCAATTCTAGTGGATCTGGAACCAGGAACCATGGACAGTGTGAGATCAGGACAATTTGGAGAGTTGTTCAGACCGGACAATTTTATTTTTGGGCAAACTGGGGCAGGAAACAACTGGGCAAAAGGACATTACACAGAAGGTGCAGAGCTTGTTGATTCTGTACTGGACATTGTCAGAAAAGAGTGTGAGCACTGTGACTGTTTGCAAGGGTTCCAGCTTACTCACTCTCTTGGAGGAGGAACGGGTTCTGGTATGGGAACACTAATGATAAGCAAGATACGAGAAGAATATCCAGACAGGATAATGAACACATTTAGTGTTATGCCGTCCCCTAAAGTCTCTGACACTGTTGTGGAGCCTTACAATGCCACCTTGTCCGTACATCAGCTGGTCGAGAACACAGATGAAACTTACTGCATTGACAACGAAGCCCTCTATGATATTTGTTTCCGTACCCTGAAACTCACTACTCCTACCTATGGGGATCTGAACCACCTGGTGTCTGCAACAATGAGTGGGGTTACCACATCGTTACGATTTCCTGGGCAGCTCAATGCTGACCTTCGCAAGTTGGCAGTCAATATGGTCCCATTTCCACGCCTCCATTTTTTCATGCCTGGATTTGCACCTTTGACTGCTCGAGGAAGTCAGCAGTATCGAGCCCTCACGGTACCAGAATTAACACAACAGATGTTTGATGCCAAGAACATGATGGCTGCTTGTGACCCACGTCATGGACGATATTTGACTGTAGCCACAGTCTTCAGAGGTCCTATGTCAATGAAGGAAGTAGATGAGCAGATGTTAGCAGTTCAGAACAAAAATAGCAGTTACTTTGTTGAATGGATCCCCAACAATGTCAAAGTAGCAGTGTGTGACATTCCTCCGCGTGGCTTGAAAATGGCTTCCACTTTCATTGGCAACAGTACAGCAATCCAAGAGATATTCAAGAGGATCTCTGAGCAGTTCTCTGCCATGTTCAGAAGAAAGGCTTTCCTGCACTGGTTCACAGGGGAAGGAATGGATGAGATGGAATTCACAGAAGCTGAAAGCAACATGAACGACCTTGTCTCAGAGTACCAGCAGTATCAAGAAGCTACAGCCAATGATGGGGAGGAGGCGTTTGAGGAAGATGAGGAAGAAGTTAATGAGTAG
Full Trace Sequence: ctcggatatatcagagctctgagggacagggaggatccattcactgcaagggctaacgggacgggctgaagggaagcagcagctatgagggaaattgtgcatatccaagcaggacagtgcgggaaccagatcggaaccaagttttgggaagtgatcagtgacgagcatggaattgatccagcaggaggatatgttggtgactcggctctgcagcttgagaggattaacgtgtactacaatgaatcatcttctcagaagtatgtgcccagggcaattctagtggatctggaaccaggaaccatggacagtgtgagatcaggacaatttggagagttgttcagaccggacaattttatttttgggcaaactggggcaggaaacaactgggcaaaaggacattacacagaaggtgcagagcttgttgattctgtactggacattgtcagaaaagagtgtgagcactgtgactgtttgcaagggttccagcttactcactctcttggaggaggaacgggttctggtatgggaacactaatgataagcaagatacgagaagaatatccagacaggataatgaacacatttagtgttatgccgtcccctaaagtctctgacactgttgtggagccttacaatgccaccttgtccgtacatcagctggtcgagaacacagatgaaacttactgcattgacaacgaagccctctatgatatttgtttccgtaccctgaaactcactactcctacctatggggatctgaaccacctggtgtctgcaacaatgagtggggttaccacatcgttacgatttcctgggcagctcaatgctgaccttcgcaagttggcagtcaatatggtcccatttccacgcctccattttttcatgcctggatttgcacctttgactgctcgaggaagtcagcagtatcgagccctcacggtaccagaattaacacaacagatgtttgatgccaagaacatgatggctgcttgtgacccacgtcatggacgatatttgactgtagccacagtcttcagaggtcctatgtcaatgaaggaagtagatgagcagatgttagcagttcagaacaaaaatagcagttactttgttgaatggatccccaacaatgtcaaagtagcagtgtgtgacattcctccgcgtggcttgaaaatggcttccactttcattggcaacagtacagcaatccaagagatattcaagaggatctctgagcagttctctgccatgttcagaagaaaggctttcctgcactggttcacaggggaaggaatggatgagatggaattcacagaagctgaaagcaacatgaacgaccttgtctcagagtaccagcagtatcaagaagctacagccaatgatggggaggaggcgtttgaggaagatgaggaagaagttaatgagtagcaaaaaataaaaaaaatcatttttggttaagcaagtgaaattagccgaagtagccaaagcaaaaatgtggtatacaagtgtgcagtgatgcagatataaggtgcagcattctgacacattcacagaaatgcaatacgggcatgtctgcacacacttcattatttccaggtcagactaacatttttactgtgatcaataaatgagtctataaatacaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MREIVHIQAGQCGNQIGTKFWEVISDEHGIDPAGGYVGDSALQLERINVYYNESSSQKYVPRAILVDLEPGTMDSVRSGQFGELFRPDNFIFGQTGAGNNWAKGHYTEGAELVDSVLDIVRKECEHCDCLQGFQLTHSLGGGTGSGMGTLMISKIREEYPDRIMNTFSVMPSPKVSDTVVEPYNATLSVHQLVENTDETYCIDNEALYDICFRTLKLTTPTYGDLNHLVSATMSGVTTSLRFPGQLNADLRKLAVNMVPFPRLHFFMPGFAPLTARGSQQYRALTVPELTQQMFDAKNMMAACDPRHGRYLTVATVFRGPMSMKEVDEQMLAVQNKNSSYFVEWIPNNVKVAVCDIPPRGLKMASTFIGNSTAIQEIFKRISEQFSAMFRRKAFLHWFTGEGMDEMEFTEAESNMNDLVSEYQQYQEATANDGEEAFEEDEEEVNE
Donor tissue: tailbud