ORFeome > ubqln2 – XORFeome 2.0

ubqln2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ubiquilin 2, mRNA (cDNA clone MGC:75576 IMAGE:5379110), complete cds
Gene Symbol: ubqln2
Gene ID: 394829
ORF gb_acc: MG132843
ORF ID: 10194

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC063190

Library Location

Plate ID: GDExt11002
Well Location: E11

EST Sequences

Clone: MGC:75576 IMAGE:5379110
Trimmed Sequence: ATGTCGGACCCCCCAAGTTCCTCCACCCCATCATCCTCGGACCCTGCCCGCATCATAAAAGTGACTGTAAAAACCCCCAAGGAGAAAGAGGAATTTGCCGTACCTGAAAATAGCAGCATCAGGGAGTTCAAGGAGGATATCTCCAAGCGCTTTAAATCCAGCACAGAACAACTTGTTTTAATATTTGCTGGAAAGATTTTAAAAGACCAGGACACCCTTAGCCAGCATGGAATCCATGATGGATTGACAGTTCACCTTGTCATCAAAACTCAAAACCGATCACAGGCTGCAACGGCTTCTCAAGCAAGCAGCTCCAGCACATCCGCTACCAACTCTACAACATCAAGCAGTAGTACCACTACAACAACAACCACAGGCACTCCTCTTGGCTTAGGAGGTCTGGGTGGGCTAGCAGGGCTGAGCAGCCTGGGCATGAATGCATCCAACTTTTCTGAACTCCAAAGTCAGATGCAGCAGCAGCTTATGTCCAACCCAGAAATGATGGTTCAGATCATGGAGAATCCATTTGTTCAGAGTATGCTTTCTAATCCTGACCTCATGAGTCAATTGATAATGGCAAATCCACAAATGCAACAGTTAATCCAGCGGAATCCAGAAATAAGCCATATGCTTAATAACCCGGATATTATGCGGCAAACATTAGAACTTGCTAGAAACCCAGCAATGATGCAAGAGATGATGAGGAACCAGGACAGAGCCCTGAGCAACTTAGAAAGTATCCCTGGTGGTTATAATGCCCTGAGAAGGATGTATACTGACATACAGGAACCCATGCTGAATGCTGCCCAAGAACAGTTCGGAGGCAATCCTTTTGCTTCTCTTGTAAGCAATGCATCAAATGCAGGCAACCAACCTTCTCGAACAGAAAATAGAGATCCTTTACCAAATCCATGGGCTCCTCCTTCTAGCACTGCAGGGTCTACATCCACTGGGAGCACTACAGGAGCAAACAGCACAGGCAGCAGTACCACCACTACAACAAGCTCAACTCTACCTAATTTGGGAGCTGGCATGTTTAATACTCCTGGCATGCAAAGCTTGATGCAACAGATAACAGAGAATCCTCAGCTGATGCAGAATATGTTGTCTGCACCATACATGAGAAGCATGATGCAGTCTCTTAGCCAGAACCCTGAACTCGCAGCTCAGGTCATGCAGAATAATCCTCTCTTTTCTGGAAATCCTCAACTGCAAGAACAGATGAGACAGCAGCTTCCATTTTTCCTTCAACAAATGCAGAACCCTGAAACTTTATCAGCAATGTCAAATCCAAGAGCAATGCAGGCTTTGCTGCAGATCCAGCAAGGGTTGCAAACACTTGCTACTGAAGCACCATCTCTAATGCCAAGAACAAATCCACCTTTTGGTGGACTGGGGAGTCCTAATTCATCACCTGCAAGTGTTCCTTCCTCTGCGCCCACAGAAAATTCAAGTCCACTGTCAGGATTATCTGAACCAGGGCATCAGCAGTTTATTCAACAAATGCTGCAAGCCCTTTCTGGTGCTAATCCACAGAATCAGAATCCAAATCCAGAAGTTAGGTTTCAGCCACAGCTCGAACAACTAAGTGCGATGGGGTTTTTAAACAGAGAAGCTAACTTACAAGCTTTAATAGCCACTGGTGGAGACATCAACGCAGCTATTGAACGACTACTGGGCTCTCAACCATCATAG
Full Trace Sequence: cagcggatgaggaagcgccgttagtgcggccttagctgcgcccaaactgcccgaaacagagaggcgtaagccaatactcgagccccattgatctatattgtatacagcgtcaacctgggctgtagctagcgggcgtccgtaacatatatccgtatgagataagctgcctgtaaatcagatttcccccaggactgacgtgcggtgcatataagcactgggaatactgacttagacacattccgctccaaggggccgcttcctgtcacttgttggaaccatgtcggaccccccaagttcctccaccccatcatcctcggaccctgcccgcatcataaaagtgactgtaaaaacccccaaggagaaagaggaatttgccgtacctgaaaatagcagcatcagggagttcaaggaggatatctccaagcgctttaaatccagcacagaacaacttgttttaatatttgctggaaagattttaaaagaccaggacacccttagccagcatggaatccatgatggattgacagttcaccttgtcatcaaaactcaaaaccgatcacaggctgcaacggcttctcaagcaagcagctccagcacatccgctaccaactctacaacatcaagcagtagtaccactacaacaacaaccacaggcactcctcttggcttaggaggtctgggtgggctagcagggctgagcagcctgggcatgaatgcatccaacttttctgaactccaaagtcagatgcagcagcagcttatgtccaacccagaaatgatggttcagatcatggagaatccatttgttcagagtatgctttctaatcctgacctcatgagtcaattgataatggcaaatccacaaatgcaacagttaatccagcggaatccagaaataagccatatgcttaataacccggatattatgcggcaaacattagaacttgctagaaacccagcaatgatgcaagagatgatgaggaaccaggacagagccctgagcaacttagaaagtatccctggtggttataatgccctgagaaggatgtatactgacatacaggaacccatgctgaatgctgcccaagaacagttcggaggcaatccttttgcttctcttgtaagcaatgcatcaaatgcaggcaaccaaccttctcgaacagaaaatagagatcctttaccaaatccatgggctcctccttctagcactgcagggtctacatccactgggagcactacaggagcaaacagcacaggcagcagtaccaccactacaacaagctcaactctacctaatttgggagctggcatgtttaatactcctggcatgcaaagcttgatgcaacagataacagagaatcctcagctgatgcagaatatgttgtctgcaccatacatgagaagcatgatgcagtctcttagccagaaccctgaactcgcagctcaggtcatgcagaataatcctctcttttctggaaatcctcaactgcaagaacagatgagacagcagcttccatttttccttcaacaaatgcagaaccctgaaactttatcagcaatgtcaaatccaagagcaatgcaggctttgctgcagatccagcaagggttgcaaacacttgctactgaagcaccatctctaatgccaagaacaaatccaccttttggtggactggggagtcctaattcatcacctgcaagtgttccttcctctgcgcccacagaaaattcaagtccactgtcaggattatctgaaccagggcatcagcagtttattcaacaaatgctgcaagccctttctggtgctaatccacagaatcagaatccaaatccagaagttaggtttcagccacagctcgaacaactaagtgcgatggggtttttaaacagagaagctaacttacaagctttaatagccactggtggagacatcaacgcagctattgaacgactactgggctctcaaccatcatagcaacatttttccaccaagaaacaaagtgtaatttatttttgataatggctcttcagtctggataaaacacctgctttatttcaatcggactcacggattaccttcttgttccaaaccagatgcattagagctggggttgaagtctagttgtttttctgagaaagtgaggcttagaggtttcgtttggatgtgctgcatgcatcaggccacacctgtaccccttcttcctgttgcattgcctcgtgattttttaaatgaatagcttttgcagttgggttaagccagggatgttcaatctttggccctccagctacggttgaacagtttgaggctggatgagactgatctgcaaggccacagcttgcttatccctgatttaactgatttcatgagtctttcagctgttaaaaggtattttgctttaaaccaatagccttctgtagtaatttatgtggaatacaaactatacaggaagtaatatgtaaggttataattagtgatacaatatcgctttttgtgacttcagcatgtatttttgctagcattgtgctgtaagattcatattgcttattaatcatttgctttcacttttttttttccttgattgggggggattaaactaaaaatgctcttttgcaacatgacaaaattattcctgacatatacacacacatgtaatcacaaacttgtctttaggaaaatatggtatagcaagtatgtgcaacagaatcttgtcaaataaatacgaaggataatccttaacaaggaacctttaatttaaatagacttctatttagttaatcactatgttagtgatattctggaacaaattgttatgctatgtcttgacaaaattcctgtaaaactgtttagtgtagcttattttgtatgacattatgccaaatttaaccaaattctgagacacttcccttgtagtgaaggcttttgaagtgtgactgactcttggtgatctgtatggagtagactgacttcactgggtcttcttttttttgcgataattttcaaaattcacatgctatttaaattcattttaacagccttgtacaaacagataatcttgagtttttatctgtagttatttctccttggcacaggaaataaaaaaacaaaccataaaaaaaaaaaaaaaaaaaaaaa
Translation: MSDPPSSSTPSSSDPARIIKVTVKTPKEKEEFAVPENSSIREFKEDISKRFKSSTEQLVLIFAGKILKDQDTLSQHGIHDGLTVHLVIKTQNRSQAATASQASSSSTSATNSTTSSSSTTTTTTTGTPLGLGGLGGLAGLSSLGMNASNFSELQSQMQQQLMSNPEMMVQIMENPFVQSMLSNPDLMSQLIMANPQMQQLIQRNPEISHMLNNPDIMRQTLELARNPAMMQEMMRNQDRALSNLESIPGGYNALRRMYTDIQEPMLNAAQEQFGGNPFASLVSNASNAGNQPSRTENRDPLPNPWAPPSSTAGSTSTGSTTGANSTGSSTTTTTSSTLPNLGAGMFNTPGMQSLMQQITENPQLMQNMLSAPYMRSMMQSLSQNPELAAQVMQNNPLFSGNPQLQEQMRQQLPFFLQQMQNPETLSAMSNPRAMQALLQIQQGLQTLATEAPSLMPRTNPPFGGLGSPNSSPASVPSSAPTENSSPLSGLSEPGHQQFIQQMLQALSGANPQNQNPNPEVRFQPQLEQLSAMGFLNREANLQALIATGGDINAAIERLLGSQPS
Donor tissue: tailbud