ORFeome > ucp2 – XORFeome 2.0

ucp2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis uncoupling protein 2 (mitochondrial, proton carrier), mRNA (cDNA clone MGC:75881 IMAGE:5383102), complete cds
Gene Symbol: ucp2
Gene ID: 394786
ORF gb_acc: MG132990
ORF ID: 10373

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063352

Library Location

Plate ID: GDExt11004
Well Location: C08

EST Sequences

Clone: MGC:75881 IMAGE:5383102
Trimmed Sequence: ATGGTTGGATTCAAGCCCACCGACATCCCACCCACAGCGGCCGTCAAATTCGTCGGCGCTGGGACAGCAGCATGTATCGCCGATCTGTTCACCTTCCCTCTGGACACGGCCAAAGTCCGACTCCAGATTCAAGGAGAGAACAAGGTGGTTAACGTGAAGGCGGCCCAGTACAAGGGAGTGTTTGGCACCATCTCTACCATGGTGAAGACGGAAGGGCCCAAGAGTCTGTACAACGGCTTGGTTGCCGGCCTGCAGCGCCAGATGAGCTTCGCCTCCGTCCGGATCGGACTCTACGACTCGGTCAAGCAATTTTACACCAAAGGATCCGAACATGTTGGGATTGGGAGCAGGCTGGCTGCTGGGTGCACCACGGGTGCTATGGCAGTGGCAGTGGCCCAGCCCACAGATGTGGTGAAGGTTCGGTTCCAAGCTCAGGCCAACTCCTCCGCCAACCGGCGCTACAAGGGGACGATGCACGCGTATCGCACCATCGCCAGGGAGGAAGGAATGCGCGGACTCTGGAAAGGAACCGCCCCCAATATCACCCGAAACGCAATCGTCAACTGCACAGAGCTGGTCACGTATGACATCATTAAAGATTCCCTCCTGAAAGCCAACATCATGACAGACAACCTGCCCTGCCATTTCACCTCTGCCTTCGGTGCCGGCTTCTGTACCACGGTGATTGCCTCCCCCGTCGATGTAGTGAAGACAAGATACATGAACTCTGCCAAAGGCCAGTACGCCAGCGCCATCAACTGTGCCCTCACCATGTTCAGGAAGGAGGGGCCCAAGGCTTTCTATAAGGGATTCATGCCGTCCTTCCTGCGCTTGGGATCCTGGAACGTGGTGATGTTTGTGACCTACGAGCAGCTGAAGAGAGCCATGATGTCGGCCCAGCGTTCCTGGGAAGCCCCTTTCTGA
Full Trace Sequence: caataagttcccggcgtcacaagatctgacacaccggcccctctaccccccattcccgctgtggagcattccctttccatccgtaccgcataaggattatggttttaaggcatcaagtttcccgccgcgtttctatggcaagtcaagagtatcaaatatttagagccagtggcaaatcagacgggcgggacgccttcagggaatcctgatcctccagcagctctcgcagcccccctgcaatactcacctaagacgttggcagagtgactttgccttgtcttctcactacacggcacttattctcaggaatccgctcctctccgcagagaaccgctcggcaccatggttggattcaagcccaccgacatcccacccacagcggccgtcaaattcgtcggcgctgggacagcagcatgtatcgccgatctgttcaccttccctctggacacggccaaagtccgactccagattcaaggagagaacaaggtggttaacgtgaaggcggcccagtacaagggagtgtttggcaccatctctaccatggtgaagacggaagggcccaagagtctgtacaacggcttggttgccggcctgcagcgccagatgagcttcgcctccgtccggatcggactctacgactcggtcaagcaattttacaccaaaggatccgaacatgttgggattgggagcaggctggctgctgggtgcaccacgggtgctatggcagtggcagtggcccagcccacagatgtggtgaaggttcggttccaagctcaggccaactcctccgccaaccggcgctacaaggggacgatgcacgcgtatcgcaccatcgccagggaggaaggaatgcgcggactctggaaaggaaccgcccccaatatcacccgaaacgcaatcgtcaactgcacagagctggtcacgtatgacatcattaaagattccctcctgaaagccaacatcatgacagacaacctgccctgccatttcacctctgccttcggtgccggcttctgtaccacggtgattgcctcccccgtcgatgtagtgaagacaagatacatgaactctgccaaaggccagtacgccagcgccatcaactgtgccctcaccatgttcaggaaggaggggcccaaggctttctataagggattcatgccgtccttcctgcgcttgggatcctggaacgtggtgatgtttgtgacctacgagcagctgaagagagccatgatgtcggcccagcgttcctgggaagcccctttctgagctgccgagacccccgttgatgctgattgggcgctatttagttctcccactatattgtttacagtaggatttgtaccactaactcccagcaactccccgcagagctgcttttgggcaggaggcagaaaagggcattttttattttgggggggcgattgggtgcaattgggggtttgctggtttccgggacacttagcgatttctcatttcgttgtctttaaatgtggcattttcttaattttattggccaaaatgtccaaaaaaaaaaaagaattttttaaagtctttaataagtgcaattgataagattttaattaagttaaaataaaacgacctacggtttacgggaacggagaatgggagtcgccggcggttacggtcgcgcacagactagagagcggtcattggtccttagggtgatgaactgcaactcccagcactctgtaacagctgaatggtgggagttgtaggtcagtcgttcattggctcctacacattccaatgtgaccaaccgctgcccaatggcttcccgttcctctgtcccggctggctcgggcccggttaaaggggcagaggcagaaaaggccgtaacttatatctgtgtctgtgcgtctgagatcattgggacgtgtgactttgcatcaaatgtttgacgaaccaactggttaatttgctttttttattctggtttttatggtgtaaaataaagtcactgtgtaacaaaaaaaaaaaaaaaaaaaaaa
Translation: MVGFKPTDIPPTAAVKFVGAGTAACIADLFTFPLDTAKVRLQIQGENKVVNVKAAQYKGVFGTISTMVKTEGPKSLYNGLVAGLQRQMSFASVRIGLYDSVKQFYTKGSEHVGIGSRLAAGCTTGAMAVAVAQPTDVVKVRFQAQANSSANRRYKGTMHAYRTIAREEGMRGLWKGTAPNITRNAIVNCTELVTYDIIKDSLLKANIMTDNLPCHFTSAFGAGFCTTVIASPVDVVKTRYMNSAKGQYASAINCALTMFRKEGPKAFYKGFMPSFLRLGSWNVVMFVTYEQLKRAMMSAQRSWEAPF
Donor tissue: neurula