ORFeome > usp3 – XORFeome 2.0

usp3 – XORFeome 2.0

General Information

Species: Xenopus tropicalis ubiquitin specific peptidase 3, mRNA (cDNA clone MGC:89592 IMAGE:6994758), complete cds
Gene Symbol: usp3
Gene ID: 448475
ORF gb_acc: MG133948
ORF ID: 11543

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075590

Library Location

Plate ID: GDExt11015
Well Location: D12

EST Sequences

Clone: MGC:89592 IMAGE:6994758
Trimmed Sequence: ATGCAAAAAAAGCATTATGAGGATGCCCAGGCTCCGCTCAATTGCCACAAACGGCAGGAAAAGACAGACAAAGACCGAATGCAGCATACAGTGTGCATGGACTGCAGCAGTTACAGTACATATTGTTACCGATGTGATGATTTTGTGGTAAACGATACAAAATTGTGTTTAGTACAGAAGGTCCGGGAGCATTTGCAGAATTTGGAAAACTCTGCTTTTACTGCTGAACGACATAGGAAAAGAAAATTCCTGGAGAGTGCCTCGCTAAGCAAGAAATTGTTGAAAGTAAATGGAAGCACAACTGCTCTATGTGCTACTGGCCTTCGGAATCTTGGAAATACCTGCTTTATGAATGCAATTCTTCAATCGCTCAGCAACATTCAGCAGTTTTGCTGTTACTTCAAGGAACTGCCTGCCGTGGAACTTCGGAATGGTAAAACGGCTGGTCGACGGACCTACCATACACGAAGCCAGGGGGATGTTAATGTGTCACTCGTTGAGGAATTTAGAAAGACCTTGTGTGCGTTATGGCAGGGTAACCAGACTGCCTTTAGTCCTGAGTCGTTGTTCTATGTGGTGTGGAAAATAATGCCAAATTTCAGGGGATATCAGCAGCAAGATGCCCATGAGTTTATGCGTTATCTCTTAGATCACCTCCATCTGGAACTACAAGGCGAATTTGATGGCTCTTCTCATTCTGTCTTATCACAGGCTAACTGCAGCCGGTCTGCCAGTAACAAATGTTGTATAAATGGTGCATCCACAGTGGTAACCTCGGTTTTTGGGGGAGTTCTACAGAATGAAGTTAACTGCCTAATTTGTGGGACAGAATCAAGAAAATTTGATCCATTCCTAGACCTCTCTTTAGATATTCCAAGCCAATTCCGAAACAAACGTTGTAAGAACCAAGAAAATGGACCAACCTGTACCCTGCGAGACTGTCTTCGCAGCTTTACAGACTTGGAGGAACTAGATGAGACAGAACTCTACACATGTCTAAAATGCAAAAAGAAACAGAAGTCCACCAAAAAGTTCTGGATCCAGAAACTACCAAAGGTGCTATGCCTACACTTGAAGAGGTTCCATTGGACAGCTTACTTGAGGAACAAGGTGGACACATATGTAGATTTTCCTCTACGAGGATTGGATATGAAGTCCTTTTTGTTAGAGCCAGAAAATATTGGGCCAGAAAGCTGTCTGTATGATCTTGCAGCTGTAGTCGTTCATCATGGCTCGGGCGTTGGATCTGGTCACTACACTGCCTATGCTACCCATAAAGGGCGCTGGTTCCATTTCAATGACAGCACAGTGACACTCACAGAAGAGGAGACTGTGGCAAAAGCAAAAGCCTATATTCTTTTTTATGTGGAGCGCCAGGTTCCTGCCACAACTGAGAAACTATAA
Full Trace Sequence: tgtgtccctccacctcgctatggagtgcccgcacctgaccaccagtgtttgtattgtcccggacgccgccgtttttcccaacggctgtccttcctcatggtgttgcagcgtttgtcgctcaaacaagagcccctgggtctgcttgacttgttccagtgtccactgtggaagatatgtaaatggtcatgcaaaaaaagcattatgaggatgcccaggctccgctcaattgccacaaacggcaggaaaagacagacaaagaccgaatgcagcatacagtgtgcatggactgcagcagttacagtacatattgttaccgatgtgatgattttgtggtaaacgatacaaaattgtgtttagtacagaaggtccgggagcatttgcagaatttggaaaactctgcttttactgctgaacgacataggaaaagaaaattcctggagagtgcctcgctaagcaagaaattgttgaaagtaaatggaagcacaactgctctatgtgctactggccttcggaatcttggaaatacctgctttatgaatgcaattcttcaatcgctcagcaacattcagcagttttgctgttacttcaaggaactgcctgccgtggaacttcggaatggtaaaacggctggtcgacggacctaccatacacgaagccagggggatgttaatgtgtcactcgttgaggaatttagaaagaccttgtgtgcgttatggcagggtaaccagactgcctttagtcctgagtcgttgttctatgtggtgtggaaaataatgccaaatttcaggggatatcagcagcaagatgcccatgagtttatgcgttatctcttagatcacctccatctggaactacaaggcgaatttgatggctcttctcattctgtcttatcacaggctaactgcagccggtctgccagtaacaaatgttgtataaatggtgcatccacagtggtaacctcggtttttgggggagttctacagaatgaagttaactgcctaatttgtgggacagaatcaagaaaatttgatccattcctagacctctctttagatattccaagccaattccgaaacaaacgttgtaagaaccaagaaaatggaccaacctgtaccctgcgagactgtcttcgcagctttacagacttggaggaactagatgagacagaactctacacatgtctaaaatgcaaaaagaaacagaagtccaccaaaaagttctggatccagaaactaccaaaggtgctatgcctacacttgaagaggttccattggacagcttacttgaggaacaaggtggacacatatgtagattttcctctacgaggattggatatgaagtcctttttgttagagccagaaaatattgggccagaaagctgtctgtatgatcttgcagctgtagtcgttcatcatggctcgggcgttggatctggtcactacactgcctatgctacccataaagggcgctggttccatttcaatgacagcacagtgacactcacagaagaggagactgtggcaaaagcaaaagcctatattcttttttatgtggagcgccaggttcctgccacaactgagaaactataaatacctcttgccatgatagtagacttcttcctctctgccccccagggtgctctccaacctcttggctaatacttgattagaatttgtttttgtgcactttttcacatcccatcagatataatcctattctgaatgatagtaaagtaacctactgcctgacagtgaataaagggagtcattttcctcaccaaaaaaaaaaaaaaaaaaa
Translation: MQKKHYEDAQAPLNCHKRQEKTDKDRMQHTVCMDCSSYSTYCYRCDDFVVNDTKLCLVQKVREHLQNLENSAFTAERHRKRKFLESASLSKKLLKVNGSTTALCATGLRNLGNTCFMNAILQSLSNIQQFCCYFKELPAVELRNGKTAGRRTYHTRSQGDVNVSLVEEFRKTLCALWQGNQTAFSPESLFYVVWKIMPNFRGYQQQDAHEFMRYLLDHLHLELQGEFDGSSHSVLSQANCSRSASNKCCINGASTVVTSVFGGVLQNEVNCLICGTESRKFDPFLDLSLDIPSQFRNKRCKNQENGPTCTLRDCLRSFTDLEELDETELYTCLKCKKKQKSTKKFWIQKLPKVLCLHLKRFHWTAYLRNKVDTYVDFPLRGLDMKSFLLEPENIGPESCLYDLAAVVVHHGSGVGSGHYTAYATHKGRWFHFNDSTVTLTEEETVAKAKAYILFYVERQVPATTEKL
Donor tissue: neurula