ORFeome > vgll2 – XORFeome 2.0

vgll2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis vestigial like 2 (Drosophila), mRNA (cDNA clone MGC:75898 IMAGE:5383453), complete cds
Gene Symbol: vgll2
Gene ID: 394785
ORF gb_acc: MG133001
ORF ID: 10387

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC063357

Library Location

Plate ID: GDExt11004
Well Location: A10

EST Sequences

Clone: MGC:75898 IMAGE:5383453
Trimmed Sequence: ATGAGCTGTCTGGATGTTATGTACCAAGTGTACGGTCCTCCTCAGCCTTACTTTGCAGCAGCATACAGTCCCTATCATCAGAAACTTGCCTTTTACTCGAAGATGCAGGAAGCCCCAGAGAGCAGCAGTACCAGCAGCAGCGCCACCAGCAGCGGCAGCTCCTTCTCCAGCCATGTGCCCCCCAGCATCAAGGAAGAGGAGTGCAGCCCAGAGAAGGAGAGGCCCCCAGAGGCAGAATACATCAGCTCCAGATGTGTCCTCTTCACTTACTTCCAGGGGGACATTAGCTCTGTGGTGGATGAGCACTTCAGCAGGGCCCTCAGCCAACCCAGCAGTTACTCCCCCAGCAGTGCCAGTGCCAAGTCGTCTAGAAGTGCCAGTACATGGAGGGATTCATCTTTCCCAATGAGCCAAAGGAGCTTCCCACCTTCATTTTGGAATAGCAGTTACCAGCCTTCTGCAGTTTCTGCTCCTTCTTCCTTAAGTAGCAGTCTAGCTAGTCCTCTCAGTGGTCCACACACAGAGATTCCATTTGGGGCAGACCCTTATTCCCCAGCATCTCTTCACAGTCACCTTCACCAAGGTCCTCCAGAGCCCTGGCACCATGCACATCATCATCACCATCATCACCACCCTTATGCAATTGGGGGAGCTATAAATACTCAAGGCTCCAGTTACCCTCGGTCAGGTATGCATGAGGTCTACAGCACGCACTTTGATCCCCGCTACAGCTCCCTCCTTGTGCCAGCTTCTGTTCGACCTCACAGGATCACCCCAGCAGGAACATCTGCATCTACTGCACAGTGTGATTTGGGAAAAGGAGAGCCAGCCACATCTGCATGGACAACACCTGGGCCATTTACAGGGCCAGCAACAGACATGGGACAGAGCATTGGCCTTAATGTAGATGCAGCTCGTCGTTACTCCTTCTGTGGCGGGACTCTCCTGAGCTGA
Full Trace Sequence: ctgcagccgagccgcttagtgcactgtagcttgtcccatactggagtttagtctgtacccgcacacgccggtctgtcaggggtagcgctgcccatcggagactgcagcttctgcacataatcacaaggatctaaccaagaggagcttgcatggaggagtaattgtggagcttgatgagaaggcaaacagagaaaagaaagcccgaactaaactaggagcatcatccctcgctagccatgagctgtctggatgttatgtaccaagtgtacggtcctcctcagccttactttgcagcagcatacagtccctatcatcagaaacttgccttttactcgaagatgcaggaagccccagagagcagcagtaccagcagcagcgccaccagcagcggcagctccttctccagccatgtgccccccagcatcaaggaagaggagtgcagcccagagaaggagaggcccccagaggcagaatacatcagctccagatgtgtcctcttcacttacttccagggggacattagctctgtggtggatgagcacttcagcagggccctcagccaacccagcagttactcccccagcagtgccagtgccaagtcgtctagaagtgccagtacatggagggattcatctttcccaatgagccaaaggagcttcccaccttcattttggaatagcagttaccagccttctgcagtttctgctccttcttccttaagtagcagtctagctagtcctctcagtggtccacacacagagattccatttggggcagacccttattccccagcatctcttcacagtcaccttcaccaaggtcctccagagccctggcaccatgcacatcatcatcaccatcatcaccacccttatgcaattgggggagctataaatactcaaggctccagttaccctcggtcaggtatgcatgaggtctacagcacgcactttgatccccgctacagctccctccttgtgccagcttctgttcgacctcacaggatcaccccagcaggaacatctgcatctactgcacagtgtgatttgggaaaaggagagccagccacatctgcatggacaacacctgggccatttacagggccagcaacagacatgggacagagcattggccttaatgtagatgcagctcgtcgttactccttctgtggcgggactctcctgagctgatcaaagattctgagtcaaaccatttatccaacatctcagctttaatcaagacctagaacatatctgaaccagctctaggactgcaaggaaaggatgaaaataggactcacaagacttttaagagccaaaaaaaatgtttcttccttctttgctgagaccagtcaaaagactgatgttatttctatttaaattgttatctaaacgttattggtgccaccctaaagaagtatatatatatatataaatataaatatatattaatataaattcactggcttacttttgacaaaggactctattttatggtgttgtgaatatttttttatgcctatgtgaatgttactttccgtgcaagctacctgttaaatgatccagttcagtatatatataactgtaagtacagtgaatactatgctgataaaacagcacatacacagagacacagagacacacataaatgaaaggtcagtggactatatgttgatatacaatccagcctatgatgtgcatggcagggaaccacctgccccaagcttatagaattgcagctgttaaacagacaactgttcaaactccagaaatatgacaagcaaggtggcacttcccagggtttagcccaacaattgcatttcttttttacaaggagaattttatgatgaaagaagaaaccctttagaaaactgacagcctttacatggaacaactgcagaagcagagtgaaagaagatctccagagagctcagcatggacaattgatctgaggcagcttctgcatgtgtgctgatgtccttctgtcactttgggaaacagagcaagatgtgtttaattgtagaacttatgcattaaaatatattcttggttttggctgtcttgtctggtaagaaaacataccatttttagttctggaaaaaaaaacttcttattccagagaagtgaccccatatcatatattgtttggtatattatgcctttcaaataaacagctgtttgggactaatctaatgtagttaatacgtaacataagatgcttttgtcttgttcattgtttagtaaaactacctgtgggcctgccatttgcaaactcagaacatttggctaatggcgccattcatttatttacccctgtattatcatatttgtcctgataaattgtctctatagccataatgaaatagatcaggaattctactgtaattaatttcacatctgtctagcttgctgggtgatcactgtttatttccatgaaggctccggtctaaaagaactgtaatttgacacaggactgaaagtaagtccactgaagaattgaatattttattcacatacctttaatgatgggcattaaagtgcattttataaatacaattgtttctgtaacttgtgtagcagaatcccaatcagtgagggtgttgatattttgatattttttttttgaccaatgagaaaatatacacatgcactgtcatgatgttatgactaaaagccaggcataatgccaaagcatgcaataaagcattatttaagaaaaaaaaaaaaaaaaa
Translation: MSCLDVMYQVYGPPQPYFAAAYSPYHQKLAFYSKMQEAPESSSTSSSATSSGSSFSSHVPPSIKEEECSPEKERPPEAEYISSRCVLFTYFQGDISSVVDEHFSRALSQPSSYSPSSASAKSSRSASTWRDSSFPMSQRSFPPSFWNSSYQPSAVSAPSSLSSSLASPLSGPHTEIPFGADPYSPASLHSHLHQGPPEPWHHAHHHHHHHHPYAIGGAINTQGSSYPRSGMHEVYSTHFDPRYSSLLVPASVRPHRITPAGTSASTAQCDLGKGEPATSAWTTPGPFTGPATDMGQSIGLNVDAARRYSFCGGTLLS
Donor tissue: neurula