ORFeome > vil1 – XORFeome 2.0

vil1 – XORFeome 2.0

General Information

Species: Xenopus tropicalis villin 1, mRNA (cDNA clone MGC:69399 IMAGE:5335381), complete cds
Gene Symbol: vil1
Gene ID: 448145
ORF gb_acc:
ORF ID: 10797

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC074679

Library Location

Plate ID: GDExt11008
Well Location: D02

EST Sequences

Clone: MGC:69399 IMAGE:5335381
Trimmed Sequence: ATGACTCAGAATCTGGAGAACATGTGTCGGAAACCCGGCCTACAGATATGGTCCATGGAGAAAATGAAACTGGTTCCCATTCCTGAGAAGGCCTACGGAAGCTTTTTCGAAGGCGACTGCTACATCCTCTTGTATAACAAACAGACCCCCAATGGCTTGATCAGTGATATTCACTACTGGATAGGGAAGGACTCCTCCCAGGATGAGCAGGGCTCGGCCGCCTTCTACGCCACGCAGATCGACGGGCTCCTCGGGGGAGGCCCAATCCAGCACCGGGAAGTGCAAGGGCACGAGTCTGCCACCTTTAAAAGTTACTTCAAGAATGGCGTCATCTACAAGAAAGGAGGGGTGTCGTCGGGGTTCAAGCACGTAGAGACAAACATGTACAACATACGGCGCCTGCTCCACGTGAAAGGGAAGAAGCACGTCACTGCCACCGAGGTAGCGATGTCCTGGAACAGCTTTAACAAAGGAGATGTTTTCCTACTGGACCTCGGCAAAGTGATCATCCAATGGAACGGACCTGAGAGCAACAAGTCTGAGAGGATCCGGGCCTGTTCCTTAGCGCAGAGCATAAGAGACGACGAAAGAGGAGGAAGAGCCCAGATTGGGGTCATAGACAACGAGCAGGATTCCCCCGATCTCATGCAGATCATGGTGGCAGTGCTGGGGGCACGGACGGGGGAGCTGAAAGATTCGGTTCCAGACGAGAAAGCGGATGAGCAACAAAAAGCAAATGTCAGACTCTATCATGTATTTGAGAAGGACGCCAATTTGGTGGTACAAGAACTCGCCACAAAGCCCCTCACTCAGGATCTCCTGCAGCACGAGGACTGCCACATTCTGGACCAGGGCGGAGTGAAGATCTACGTTTGGAGGGGTAAAAACTCCAGCCCGGAGGAGAAGTCGGCAGCTTTCAGCAGAGCCGTGGGTTTCATACAAGCCAAGGGCTACCCCCCGACTACCAATGTGGAGGTGGTCAACGATGGCGCCGAGTCGGCCATGTTCAAGCAGCTGTTCCAGAACTGGAAGGACGTCGGGGAAACACAGGGCCTGGGAAAGACTTTTAGCGTCGGCAAAATCGCCAAAGTGGAACAAACGAAATTCGACGTGAACCAGCTCTATGCCCGCCCGGAATTAGCCGCCGAGCAGCGGATGGTGGACGACGCGTCTGGGAACGTTGAGGTCTGGAGAATCGAAAAGCTGGAACTGGCAGAGGTGGAACCCAGGACCTACGGACAGTTCTACGGGGGAGACTGCTACTTAATTCTCTATACGTATATGAAGTCTGGGCGGCCCAATTACCTTCTCTACATGTGGCTGGGCCGTCACGCCAGCCAGGATGAAATTACAGCGTGTGCGTTCCAAGCCGTCCAACTGGACAAGAAGTACCATGACCAACCAGTCCAAATCCGAGTCACTATGGGAAAGGAACCCAGACATCTGCAGGCCATGTTCAAAGGGAAAATGATTATATATGAGGGTGGAACGAGTCGATTGGGGGTGCATGAACCAGAGGCACCAATCAAACTGTTCCAAGTGAAAGGAACCAATGAGTACAACACCAAAGCCACAGAAGTCCCGGCAAGAGCATCTTCCCTTAATTCCAACGATGTGTTTGTGCTGAAGACGGAGTCTATGTGCTACCTCTGGTGTGGCAAGGGCTGCAGTGGGGACGAGCGGGAAATGGCAAAGACCGTGGCAAACATCATCTCCAAGCAGGACAAGCAGACCATCCTCGAGGGCCAAGAGCCCGCAGAATTCTGGGTCGCCCTCGGAGGGAAAGCCCCCTATGCAAGTGATAAAAGGTTCCAGGAGCAGGCAGTGCAGTACTCGCCTCGGCTCTTTGAATGCTCCAACCAGACCGGCCGCTTTGTGATGACGGAAGTGGTGGATTTCTGCCAGAGTGACCTGGATGAGGACGACGTCATGTTGCTGGATACCTGGGAGGAGATTTTTCTCTGGGTTGGTAAATCAGCGAATGACTATGAGAAGACGGAGTCGGTTAAAGCATCGCAGGAGTATCTGAGGGCACATCCTGCGGGACGGGACTTGGCCACACCCATCATTCTGGTCAAACAAGGACACGAACCTCCCACCTTCACCGGATGGTTCAACGCTTGGGATTCCCATAAGTGGAGTTCGGACCTGTCGTATGAAGACATGAAGAAGACCTTGGGTGATGTCTCGGCAATCTCACAGATTAGTGTGGACCTTCAAAACACCAACCTGAACAAGAAGAGCACGAGCAATGCCCCCCCCACGAGCAGTGCCCCCCCCACGAGCAGTGCCCCCGAGAGTGTCCCCATCCCCATGTACAGGTCCCACAGCCAAGAGAACCTGCAGTATAACAACGGTCACCAAGCAACGACCAATGGGAGCCAGGTTCCGAACCAAGTCAAACAGAACCCCGAGCCCCTGCCGGAGAGCAACGGCAACCAATGGTTTGACAGATCTTTCCTGATCAACAAGGTCACAGAGGACTTGCCCGACGGAGTGGATCCAACCAAGAAGGAGATGTACTTGTCCGACGCAGACTTTGCCGCCATTATGGGGATGCCCAAAGCACAGTTCTACCAGATGCCAAAATGGAAGCAACAAAATCTGAAGAAGCAACACGGGCTGTTCTAG
Full Trace Sequence: ctctgctgctgtcagtggaacagccctggagttgggagtgtgagccctgagactagaaggggggttttctgtcatctcatctgccattcagttttcccgcaaaatgactcagaatctggagaacatgtgtcggaaacccggcctacagatatggtccatggagaaaatgaaactggttcccattcctgagaaggcctacggaagctttttcgaaggcgactgctacatcctcttgtataacaaacagacccccaatggcttgatcagtgatattcactactggatagggaaggactcctcccaggatgagcagggctcggccgccttctacgccacgcagatcgacgggctcctcgggggaggcccaatccagcaccgggaagtgcaagggcacgagtctgccacctttaaaagttacttcaagaatggcgtcatctacaagaaaggaggggtgtcgtcggggttcaagcacgtagagacaaacatgtacaacatacggcgcctgctccacgtgaaagggaagaagcacgtcactgccaccgaggtagcgatgtcctggaacagctttaacaaaggagatgttttcctactggacctcggcaaagtgatcatccaatggaacggacctgagagcaacaagtctgagaggatccgggcctgttccttagcgcagagcataagagacgacgaaagaggaggaagagcccagattggggtcatagacaacgagcaggattcccccgatctcatgcagatcatggtggcagtgctgggggcacggacgggggagctgaaagattcggttccagacgagaaagcggatgagcaacaaaaagcaaatgtcagactctatcatgtatttgagaaggacgccaatttggtggtacaagaactcgccacaaagcccctcactcaggatctcctgcagcacgaggactgccacattctggaccagggcggagtgaagatctacgtttggaggggtaaaaactccagcccggaggagaagtcggcagctttcagcagagccgtgggtttcatacaagccaagggctaccccccgactaccaatgtggaggtggtcaacgatggcgccgagtcggccatgttcaagcagctgttccagaactggaaggacgtcggggaaacacagggcctgggaaagacttttagcgtcggcaaaatcgccaaagtggaacaaacgaaattcgacgtgaaccagctctatgcccgcccggaattagccgccgagcagcggatggtggacgacgcgtctgggaacgttgaggtctggagaatcgaaaagctggaactggcagaggtggaacccaggacctacggacagttctacgggggagactgctacttaattctctatacgtatatgaagtctgggcggcccaattaccttctctacatgtggctgggccgtcacgccagccaggatgaaattacagcgtgtgcgttccaagccgtccaactggacaagaagtaccatgaccaaccagtccaaatccgagtcactatgggaaaggaacccagacatctgcaggccatgttcaaagggaaaatgattatatatgagggtggaacgagtcgattgggggtgcatgaaccagaggcaccaatcaaactgttccaagtgaaaggaaccaatgagtacaacaccaaagccacagaagtcccggcaagagcatcttcccttaattccaacgatgtgtttgtgctgaagacggagtctatgtgctacctctggtgtggcaagggctgcagtggggacgagcgggaaatggcaaagaccgtggcaaacatcatctccaagcaggacaagcagaccatcctcgagggccaagagcccgcagaattctgggtcgccctcggagggaaagccccctatgcaagtgataaaaggttccaggagcaggcagtgcagtactcgcctcggctctttgaatgctccaaccagaccggccgctttgtgatgacggaagtggtggatttctgccagagtgacctggatgaggacgacgtcatgttgctggatacctgggaggagatttttctctgggttggtaaatcagcgaatgactatgagaagacggagtcggttaaagcatcgcaggagtatctgagggcacatcctgcgggacgggacttggccacacccatcattctggtcaaacaaggacacgaacctcccaccttcaccggatggttcaacgcttgggattcccataagtggagttcggacctgtcgtatgaagacatgaagaagaccttgggtgatgtctcggcaatctcacagattagtgtggaccttcaaaacaccaacctgaacaagaagagcacgagcaatgccccccccacgagcagtgccccccccacgagcagtgcccccgagagtgtccccatccccatgtacaggtcccacagccaagagaacctgcagtataacaacggtcaccaagcaacgaccaatgggagccaggttccgaaccaagtcaaacagaaccccgagcccctgccggagagcaacggcaaccaatggtttgacagatctttcctgatcaacaaggtcacagaggacttgcccgacggagtggatccaaccaagaaggagatgtacttgtccgacgcagactttgccgccattatggggatgcccaaagcacagttctaccagatgccaaaatggaagcaacaaaatctgaagaagcaacacgggctgttctagagaaattgcttcgctgacgaacttaatggtccctcccccagccccgcccccctttcccctgaaatatgtttatttacaagaagccccgccttccccttatgctttataccccgtgccagcgcagtcatgtgactaatgtgtgaggagccctgacttcgccggtgccatattgttactggatgttcataggtggagcagaggaggcgggatcatatgagggcagccatattgcatcgctgtaagggtcactgcacatcgtcaggcagccacgtgcaaaataaatctaataatatataaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MTQNLENMCRKPGLQIWSMEKMKLVPIPEKAYGSFFEGDCYILLYNKQTPNGLISDIHYWIGKDSSQDEQGSAAFYATQIDGLLGGGPIQHREVQGHESATFKSYFKNGVIYKKGGVSSGFKHVETNMYNIRRLLHVKGKKHVTATEVAMSWNSFNKGDVFLLDLGKVIIQWNGPESNKSERIRACSLAQSIRDDERGGRAQIGVIDNEQDSPDLMQIMVAVLGARTGELKDSVPDEKADEQQKANVRLYHVFEKDANLVVQELATKPLTQDLLQHEDCHILDQGGVKIYVWRGKNSSPEEKSAAFSRAVGFIQAKGYPPTTNVEVVNDGAESAMFKQLFQNWKDVGETQGLGKTFSVGKIAKVEQTKFDVNQLYARPELAAEQRMVDDASGNVEVWRIEKLELAEVEPRTYGQFYGGDCYLILYTYMKSGRPNYLLYMWLGRHASQDEITACAFQAVQLDKKYHDQPVQIRVTMGKEPRHLQAMFKGKMIIYEGGTSRLGVHEPEAPIKLFQVKGTNEYNTKATEVPARASSLNSNDVFVLKTESMCYLWCGKGCSGDEREMAKTVANIISKQDKQTILEGQEPAEFWVALGGKAPYASDKRFQEQAVQYSPRLFECSNQTGRFVMTEVVDFCQSDLDEDDVMLLDTWEEIFLWVGKSANDYEKTESVKASQEYLRAHPAGRDLATPIILVKQGHEPPTFTGWFNAWDSHKWSSDLSYEDMKKTLGDVSAISQISVDLQNTNLNKKSTSNAPPTSSAPPTSSAPESVPIPMYRSHSQENLQYNNGHQATTNGSQVPNQVKQNPEPLPESNGNQWFDRSFLINKVTEDLPDGVDPTKKEMYLSDADFAAIMGMPKAQFYQMPKWKQQNLKKQHGLF
Donor tissue: tailbud