ORFeome > vps16 – XORFeome 2.0

vps16 – XORFeome 2.0

General Information

Species: Xenopus tropicalis vacuolar protein sorting 16 homolog, mRNA (cDNA clone MGC:89386 IMAGE:6989080), complete cds
Gene Symbol: vps16
Gene ID: 448414
ORF gb_acc: MG133881
ORF ID: 11466

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075508

Library Location

Plate ID: GDExt11014
Well Location: C08

EST Sequences

Clone: MGC:89386 IMAGE:6989080
Trimmed Sequence: ATGGATTTCTATACCGCTAACTGGTACCCAATGGGCAGCGTTTATTACCGTAAGTTTGATTGCTACCGCATGGAGTGGGACCTGAGAGACGGCTTCAGGGAGTGCCTTGTGGCCGCCGGGCCCTACGCCGGCACCGTCGCTCTAATGAGGAATTACTGTGCCAAGCCGGGCCGGCCCATTCTGGAGATTTACTCTGCCGCCGGCGTCCTGTTGTCCTCCATCCCGTGGAAGAGCGGCCAGGTGGTGCACTTGGGCTGGACCCTCACCCAGGACCTGGTTTGTATCCAGGAGGATGGGACGGTGCTTATCTACGACATATTCTGCGCATTCAAGCGCCACTTCAGCCTGGGGAGCGAGGTGAAACAGAACCAGGTCCTGGAGGCCAAAGTGTTCCACACCGAGTACAGAACCGGCATCGCCATCTTAACCGGAGCCTTGAAATTCACCGTCGCTTCCAACATCGATGACGTGAAACTGCGCAGGTTGCCGGAAATACCGGCCCTCAGGGGCCCCCCTACCTGCTGGACTGTACTGTTTAACGACCGAGTGCCTCTAGTCTTGGCTGCCGTTGGGCCAGATCTGTACCTGTTGGACAATACCTCTTGCACCGCCGTTACACTGCCCGGAATGAGCCCCCTGGCCGGGTCAGCTCTGCAAATGGCCGTCTCCTTTAATTACAAGTACCTCGCAGTCTTCACAGACACCGGGTACATCTGGATGGGGACGGCTTCCCTGACGGATAAACTGTGCGAGTTTTCCTCCGATCTACGACAGGCGCCAAAGCAAATGGCTTGGTGTATAAGGCCCGGCAGCCGCAACATTGCGCTCGCACTAATGTGGGAAAAACTCATATTCCTAGTCGGCCGTGCCCGCGAGGGCGTTCACTTCCCGCTGGACGAGCCGTCGTTTATAGTTCCCGAACTTGATGGGATCAGAATCGTATCTTCCTCCACCCACGAGTTTCTCCACGAAATACCGAAAGTGACCGAGGACATTTTTAAAATTGCCTCCATGGCGCCCGGAGCTCTTTTGCTCGAAGCCCAAAAGGAATATGAGAAAGAGAGCCAGAAAGCGGACGACTATCTGCGGGAGATTAAGGACCAGAACCACCTGTCGGACGCAGTGGAGAACTGCATAGAAGCCGCGGGCTACGAGCACGCCCCCGAGATGCAGAAGTCTCTCCTCAGAGCAGCTTCATTCGGAAAATGCTTTGTGGAAAAATATTCTCCCGCGGACTTTGTGACTATGTGCCAAGATCTCCGTATCCTCAACGCCATCCATGACTACCAGATCGGTATCCCGCTGACTATGACTCAGTACAAGCAACTCACCATACAGGTTCTGTTGGACAGATTAGTCTTACGGAGACTTTATCCCCTCGCTCTCAAAATTTGTGAATATCTAAAGTTTTCTGATTTCCAGGGTGTCAGTCGGATTTTAGCTCATTGGGCTTGTTACAAGGTGCAACAAAAGGAGAAATCTGATGATGAGATAGCTCAGGCCATTAATCAGAAGCTTGGAGACACCCTCGGAATTTCCTACTCTGAAATTGCCTCCAGGGCCTGTGAGTGTGGTAGGACGGAGTTGGCCATTAAACTCTTAGAGTACGAACCAAAGTCGGAAGATCAAGTTCCATTGCTTTTAAAGATGAAGAGAAGCAACTTAGCCCTGGCCAAAGCCATCGAGAGCGGGGACACGGACCTTGTGTATACTGTGGTTACTTACATGAAAAACGAGTTTAACCGAGGCGACTTCTTTATGACATTGCAGAACCACCCGGTGGCTTTGAGTTTATACAGACAGTTCTGCAAGCACCAAGAACCCGAGACACTGAAGGACCTTTACAATCAGGATGATAATCATCTGGAGCTGGGTAATTTCTATGTTCGATCCAGTTACGGTGCAGAGAAAAGGGTGGAAGGGCGGGTTGCGGAGCTCCAAAACGCTGTAGAGGAGTACAACAAAGCTAAGAGTGAACTGGCGGCCAGGGCCACCGAGGATCAGATCAAGCTGCTGAGGAACCAGCGGGCACTGCAGGATAAGGTGGACAAGCCGTACCTGGACTTCTCGCTGCACGACACCGTTTACAATCTCATACTGGACGGCATGCACAAGAAAGCAGAGCAACTGTACAAAGAATTCAAAATCCCTGACAAAAGGTACTGGTGGCTCAAAATCTCTGCTTTGGCGGAGAAAGAGGACTGGGAGGAGCTTGAGAAGTTCTCGAAAAGTAAGAAATCTGCCATCGGCTACTTGCCCTTTGTGGAGATTTGCATGAAGCATCAGAACAAAGTGGAAGCCAAGAAGTACATCGCCCGCGTGGGTATCGAGCAGCGGGTCAAAGCCTTCCTCTTGGTTGGGGACTTGGATCAGGCTGCCGAAAGCGCCATCGAGCACCGAAATGAACAAGAAATGAATATGGTGCTGTCCCGCTGCGCCTCGGCCGCTGATAACACCATTGTGGAGAAGATCAACCGCGCCAAGTCCCTGATCCTCAAGAAATAA
Full Trace Sequence: ccggagacgagctgctgagtgacagcgccgctacagtgaggggagccggtcacatgacagcaggctggggagccggtcacatgacagcaggctggggagccaatcacatgacagcaggctggggagccaatcacatgacagcaggctggggagccaatcacaggatacagggctagtagttgcctgactccagtttgacaagccgggctcccaggttggtgccccaaggccgcagccatggatttctataccgctaactggtacccaatgggcagcgtttattaccgtaagtttgattgctaccgcatggagtgggacctgagagacggcttcagggagtgccttgtggccgccgggccctacgccggcaccgtcgctctaatgaggaattactgtgccaagccgggccggcccattctggagatttactctgccgccggcgtcctgttgtcctccatcccgtggaagagcggccaggtggtgcacttgggctggaccctcacccaggacctggtttgtatccaggaggatgggacggtgcttatctacgacatattctgcgcattcaagcgccacttcagcctggggagcgaggtgaaacagaaccaggtcctggaggccaaagtgttccacaccgagtacagaaccggcatcgccatcttaaccggagccttgaaattcaccgtcgcttccaacatcgatgacgtgaaactgcgcaggttgccggaaataccggccctcaggggcccccctacctgctggactgtactgtttaacgaccgagtgcctctagtcttggctgccgttgggccagatctgtacctgttggacaatacctcttgcaccgccgttacactgcccggaatgagccccctggccgggtcagctctgcaaatggccgtctcctttaattacaagtacctcgcagtcttcacagacaccgggtacatctggatggggacggcttccctgacggataaactgtgcgagttttcctccgatctacgacaggcgccaaagcaaatggcttggtgtataaggcccggcagccgcaacattgcgctcgcactaatgtgggaaaaactcatattcctagtcggccgtgcccgcgagggcgttcacttcccgctggacgagccgtcgtttatagttcccgaacttgatgggatcagaatcgtatcttcctccacccacgagtttctccacgaaataccgaaagtgaccgaggacatttttaaaattgcctccatggcgcccggagctcttttgctcgaagcccaaaaggaatatgagaaagagagccagaaagcggacgactatctgcgggagattaaggaccagaaccacctgtcggacgcagtggagaactgcatagaagccgcgggctacgagcacgcccccgagatgcagaagtctctcctcagagcagcttcattcggaaaatgctttgtggaaaaatattctcccgcggactttgtgactatgtgccaagatctccgtatcctcaacgccatccatgactaccagatcggtatcccgctgactatgactcagtacaagcaactcaccatacaggttctgttggacagattagtcttacggagactttatcccctcgctctcaaaatttgtgaatatctaaagttttctgatttccagggtgtcagtcggattttagctcattgggcttgttacaaggtgcaacaaaaggagaaatctgatgatgagatagctcaggccattaatcagaagcttggagacaccctcggaatttcctactctgaaattgcctccagggcctgtgagtgtggtaggacggagttggccattaaactcttagagtacgaaccaaagtcggaagatcaagttccattgcttttaaagatgaagagaagcaacttagccctggccaaagccatcgagagcggggacacggaccttgtgtatactgtggttacttacatgaaaaacgagtttaaccgaggcgacttctttatgacattgcagaaccacccggtggctttgagtttatacagacagttctgcaagcaccaagaacccgagacactgaaggacctttacaatcaggatgataatcatctggagctgggtaatttctatgttcgatccagttacggtgcagagaaaagggtggaagggcgggttgcggagctccaaaacgctgtagaggagtacaacaaagctaagagtgaactggcggccagggccaccgaggatcagatcaagctgctgaggaaccagcgggcactgcaggataaggtggacaagccgtacctggacttctcgctgcacgacaccgtttacaatctcatactggacggcatgcacaagaaagcagagcaactgtacaaagaattcaaaatccctgacaaaaggtactggtggctcaaaatctctgctttggcggagaaagaggactgggaggagcttgagaagttctcgaaaagtaagaaatctgccatcggctacttgccctttgtggagatttgcatgaagcatcagaacaaagtggaagccaagaagtacatcgcccgcgtgggtatcgagcagcgggtcaaagccttcctcttggttggggacttggatcaggctgccgaaagcgccatcgagcaccgaaatgaacaagaaatgaatatggtgctgtcccgctgcgcctcggccgctgataacaccattgtggagaagatcaaccgcgccaagtccctgatcctcaagaaataactttatgctcatttggcttcttgccgtctggtgggtattttacttaatgagcagctattatacatattgattgctctgtaactagccctggcccgtagccctctgcattcaattggtagcccccgttccctagtgatccccaaccagtggctcgggggcaacatgatgcccgtttgatgttggtcccagtgatcccaaagtaggtgccatttttacatttctggcttggagggaagtttttacgccaagcagaacctcctgcagcccagcagtcacatggggctaccaaatagccaatcacagtccttgttttccatccccaaagaaccttgctaatgcttgtgtggttccccaataccttttacatctgagtgtggctcctgagtaaaataggttggggatccctgctgtaggggttctggtccagtggtgccccagttatgtagttaggcactcacaggcattgggtcgtgggccagcagctccagctgaaaggggaggccacacttatggaccctcagggctaagtggaaatgatgggggtgagattgtaattaaatggattctgggagtctagtccagcagtcccgccccttaacacataccagaaagctggttggatgttccctttccccatgcccctgtatgggtccaactgccaggcctgcagaaccgatatctgggcaggtgtaaaaatctgttgctgtgatctgattggataagccccacattacccaccaccaaggcggccatatctctatatgatatcattgctctcctgggacacattgaactgtatccttgcactttgtcctgctttgcctgtgcccccacgtacatacattcaggatctgtgttggggaggtgtagctgatggtgggggggagttataagcacttccctttggtttatgtacagtaaccagtactagttatgtgtagaaccactgctaataaatgtgctgtttgcaactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDFYTANWYPMGSVYYRKFDCYRMEWDLRDGFRECLVAAGPYAGTVALMRNYCAKPGRPILEIYSAAGVLLSSIPWKSGQVVHLGWTLTQDLVCIQEDGTVLIYDIFCAFKRHFSLGSEVKQNQVLEAKVFHTEYRTGIAILTGALKFTVASNIDDVKLRRLPEIPALRGPPTCWTVLFNDRVPLVLAAVGPDLYLLDNTSCTAVTLPGMSPLAGSALQMAVSFNYKYLAVFTDTGYIWMGTASLTDKLCEFSSDLRQAPKQMAWCIRPGSRNIALALMWEKLIFLVGRAREGVHFPLDEPSFIVPELDGIRIVSSSTHEFLHEIPKVTEDIFKIASMAPGALLLEAQKEYEKESQKADDYLREIKDQNHLSDAVENCIEAAGYEHAPEMQKSLLRAASFGKCFVEKYSPADFVTMCQDLRILNAIHDYQIGIPLTMTQYKQLTIQVLLDRLVLRRLYPLALKICEYLKFSDFQGVSRILAHWACYKVQQKEKSDDEIAQAINQKLGDTLGISYSEIASRACECGRTELAIKLLEYEPKSEDQVPLLLKMKRSNLALAKAIESGDTDLVYTVVTYMKNEFNRGDFFMTLQNHPVALSLYRQFCKHQEPETLKDLYNQDDNHLELGNFYVRSSYGAEKRVEGRVAELQNAVEEYNKAKSELAARATEDQIKLLRNQRALQDKVDKPYLDFSLHDTVYNLILDGMHKKAEQLYKEFKIPDKRYWWLKISALAEKEDWEELEKFSKSKKSAIGYLPFVEICMKHQNKVEAKKYIARVGIEQRVKAFLLVGDLDQAAESAIEHRNEQEMNMVLSRCASAADNTIVEKINRAKSLILKK
Donor tissue: gastrula