ORFeome > wasl – XORFeome 2.0

wasl – XORFeome 2.0

General Information

Species: Xenopus tropicalis Wiskott-Aldrich syndrome-like, mRNA (cDNA clone MGC:75618 IMAGE:5379332), complete cds
Gene Symbol: wasl
Gene ID: 407864
ORF gb_acc: MG133442
ORF ID: 10959

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC067309

Library Location

Plate ID: GDExt11009
Well Location: E07

EST Sequences

Clone: MGC:75618 IMAGE:5379332
Trimmed Sequence: ATGAGTAACAATATCGGCCCTAATAATAACAACAACAGGCAGACCAAAAGGGTGACAAACAGCGGCTCCATACTGCTCACCGCGCAGGAAAATGAAAGTCTCTTTAGTTACCTGGGCAAGAAGTGTGTGACCATGACTTCAGCAGTTGTTCAGGTATTTTTGTCAGATCGCAACTCTATGTGGGTTAAGAAATGCTGTGGAGTGGTGTGCCTGGTAAAGGACAATCCACAAAGGTCGTATTTTATTAGAGTTTATGATATCAAGGAAGGTAGACAACTCCATGAACAGGAACTGTACTATAATTTTGTATATAATAGCCCAAGACCGTATTTTCACACTTTTCCTGGAGATACATGTCAGATTGGTCTAAACTTTGCAAGTGAAGAAGAAGCAAAAAGATTCCGAAAAGCAACGACTGATTTAATTTCAAGAAGACCAAGGAAACCTGATAAGAAGCGAGAACCTCCAAATGGGCCAAGTCTACCAATGGCAACCGTTGACATTAAAAACCCAGAAATCACAAACAGATATAATGCACAAGTGAACAACATTCCATACAAAAATGACAAGAAAAAGGGAAAAACTAAGAAGAAAAAACTTACAAAAGCTGATATTGGAACTCCAAGTAACTTTCAACACATTGGACATGTGGGTTGGGATCCAAACACAGGCTTTGATGTCAACAATTTGGACCCGGAGCTTAAAAAGTTGTTTGACTTATGTGGCATATCAGAAGCTCAGCTGAAAGATAAAGAAACATCAAAAGTAATTTATGATTTCATTGAAAAAACAGGAGGTGTCGAAGCTGTCAAAAATGAGTTGCGCAGGCAGGCACCACCACCCCCTCCTCCATCTCGAGGAGGTCCACCACCACCACCACCTCCACATAGTTCAGGACCACCACCACCGCCACCTCCTGCAAGGGGTAGAGGCGCCCCACCACCACCTCCATCCAGGGCACCAACAACAGCTCCTCCACCTCCACCACCTATCAGGCCAGGGCAGTCGGGGCCTCCACCACCTCCTAATAGAATGTATCCACCACCACCGCCAGGGCATACCTCCTCTGCACCCTCAAGTCCCCCACCTCCACCACCTCCTCCACCTTCATCTGGTTTTGGAGCCGCTGCCCCACCTCCTCCACCACCACCACCACCACCTGGCCCCCCTCCTGATTTTTCTACAGAAAATGATAATCACTCTGCTGTTTCTGGTGCAAACAAATCTGCACTTCTGGATCAGATTAGAGGAGGCGCTACACTTAGGAAAGTAGACAACAGAGAAAGTCGACCAACGTCCACATCTGGAAGAGATGCCCTGCTAGATCAAATTCGACAGGGCATACAGCTGAAATCTGTACCTGATGAGTCAGACACAGTGGCATCTACCCCTGCACCTGCACCCACCACAGGAATTGTAGGAGCACTGATGGAAGTTATGAAGAAAAGGAGTAAAGCCATTCATTCTTCAGATAGCGATGAAGATGAGGATGAAGAAGAAGACTTTGATGATGAGGATGATGAATGGGAGGATTGA
Full Trace Sequence: cgacaagcggccgggatatgaagcggccctgatcctgcgctgaggggcgatactgacttatagaatctctgcagggaccgaagggagagattccctgccaacactaatcatgagtaacaatatcggccctaataataacaacaacaggcagaccaaaagggtgacaaacagcggctccatactgctcaccgcgcaggaaaatgaaagtctctttagttacctgggcaagaagtgtgtgaccatgacttcagcagttgttcaggtatttttgtcagatcgcaactctatgtgggttaagaaatgctgtggagtggtgtgcctggtaaaggacaatccacaaaggtcgtattttattagagtttatgatatcaaggaaggtagacaactccatgaacaggaactgtactataattttgtatataatagcccaagaccgtattttcacacttttcctggagatacatgtcagattggtctaaactttgcaagtgaagaagaagcaaaaagattccgaaaagcaacgactgatttaatttcaagaagaccaaggaaacctgataagaagcgagaacctccaaatgggccaagtctaccaatggcaaccgttgacattaaaaacccagaaatcacaaacagatataatgcacaagtgaacaacattccatacaaaaatgacaagaaaaagggaaaaactaagaagaaaaaacttacaaaagctgatattggaactccaagtaactttcaacacattggacatgtgggttgggatccaaacacaggctttgatgtcaacaatttggacccggagcttaaaaagttgtttgacttatgtggcatatcagaagctcagctgaaagataaagaaacatcaaaagtaatttatgatttcattgaaaaaacaggaggtgtcgaagctgtcaaaaatgagttgcgcaggcaggcaccaccaccccctcctccatctcgaggaggtccaccaccaccaccacctccacatagttcaggaccaccaccaccgccacctcctgcaaggggtagaggcgccccaccaccacctccatccagggcaccaacaacagctcctccacctccaccacctatcaggccagggcagtcggggcctccaccacctcctaatagaatgtatccaccaccaccgccagggcatacctcctctgcaccctcaagtcccccacctccaccacctcctccaccttcatctggttttggagccgctgccccacctcctccaccaccaccaccaccacctggcccccctcctgatttttctacagaaaatgataatcactctgctgtttctggtgcaaacaaatctgcacttctggatcagattagaggaggcgctacacttaggaaagtagacaacagagaaagtcgaccaacgtccacatctggaagagatgccctgctagatcaaattcgacagggcatacagctgaaatctgtacctgatgagtcagacacagtggcatctacccctgcacctgcacccaccacaggaattgtaggagcactgatggaagttatgaagaaaaggagtaaagccattcattcttcagatagcgatgaagatgaggatgaagaagaagactttgatgatgaggatgatgaatgggaggattgatcaatacatatatataatatatatatatattttttaagaatgaatactaaacactttctgtctatggattctgtaaaattatcatgtaaattgtctaccaatttgctgtatatttttgttgccttttgctttttttattaatctgtgcaatacctcactcaaaatgcaaaggtttagtcataatgctccacacagcttcttccctctaaatgtgcgcaaacacatccaattgctcattgcattggaggctaaacagcattgaactgacagaagtggaacggtgactgaataaccttttaattgttataatgaaaaaaaaaaagaaacactattttcttaccctaattttctgtacctaaatttcttattaaaatctagaatagcactacatttgttttttaagtgacgctgatcttggcttactaagccatttcattttgaatgcaaaaagtatgttgattatgtatgtatgtatgtattaaatccttctttgcacgttttggttcacactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MSNNIGPNNNNNRQTKRVTNSGSILLTAQENESLFSYLGKKCVTMTSAVVQVFLSDRNSMWVKKCCGVVCLVKDNPQRSYFIRVYDIKEGRQLHEQELYYNFVYNSPRPYFHTFPGDTCQIGLNFASEEEAKRFRKATTDLISRRPRKPDKKREPPNGPSLPMATVDIKNPEITNRYNAQVNNIPYKNDKKKGKTKKKKLTKADIGTPSNFQHIGHVGWDPNTGFDVNNLDPELKKLFDLCGISEAQLKDKETSKVIYDFIEKTGGVEAVKNELRRQAPPPPPPSRGGPPPPPPPHSSGPPPPPPPARGRGAPPPPPSRAPTTAPPPPPPIRPGQSGPPPPPNRMYPPPPPGHTSSAPSSPPPPPPPPPSSGFGAAAPPPPPPPPPPGPPPDFSTENDNHSAVSGANKSALLDQIRGGATLRKVDNRESRPTSTSGRDALLDQIRQGIQLKSVPDESDTVASTPAPAPTTGIVGALMEVMKKRSKAIHSSDSDEDEDEEEDFDDEDDEWED
Donor tissue: tailbud