ORFeome > xylt2 – XORFeome 2.0

xylt2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis xylosyltransferase II, mRNA (cDNA clone MGC:89331 IMAGE:6987559), complete cds
Gene Symbol: xylt2
Gene ID: 448400
ORF gb_acc: MG133897
ORF ID: 11489

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075489

Library Location

Plate ID: GDExt11014
Well Location: E07

EST Sequences

Clone: MGC:89331 IMAGE:6987559
Trimmed Sequence: ATGGCGCCAAGCGTACGGGGACTGAAGCTCGGCCGCCGATACAAACTGTTAGCCGGAGCCGCGCTGGTACTGCTGCTCATACAGGGCCTGGCGGTGTGGAGCTTCAGCGGGCTGGAGGGGGACGGGAAGGAGAATTCCCTGCCAAGGGTAAATAGAAGCCCAGATAATGGAGAAGTCGCCAAGGACTCAGACAGTTCTGCAGGGAGTAGGTCGCAGAGATGGACGGTAAGACCAGAAAGAAGGAGCAGCGATGGGAGCAAGATAACAAGAAAGGCCACGGTAACCCGCAAACAGAGGCCGCCGGCCCAAGTCTTCCATGGGAATTGGCACAATCTCACCCGAGAGGGGGACACGGGCAGTGTGGAGGGGGCACCTCACCAATCAGACCGTGGCTTCACTCCGAAGTGTGAGATCACAGGAAAGGATGCCCTCTCCGCTCTCGCCAGAGCTAGAACCCACCAGTGCCAACAGGAGATCGCTAACTTGGTGTGCCTTCACCAGGCGGGAGAGCTTATGCCAAGAAATGTCCAACGGCAGTGCCAAACCACAGGAAAGGTTAACACAGGCTTAACATGGGAGGAGTCAGATGCGGTTGCTCCACCCCCTGAAAAGCCTTTACGTGTGTTGTATATGCTGGTCGTGCACGGCAGAGCTATACGGCAATTGAAACGTCTCATCAAGGCCATTTACCATCAAGATCACTTCTACTACATCCACGTGGATCAGCGATCCAACTACCTTCACCGGGAAGTGGTCCGCCTAGCGCAGTCATATGAGAATATGCGCGTCACCCCTTGGCGCATGGTGACCATATGGGGAGGAGCCAGCCTTCTGACCATGTATCTACGCAGCATGAAGGACCTGCTGGAGGTGCCCGACTGGCCTTGGGACTTCTTTATCAACTTGAGTGCCACTGACTACCCTACAAGGACCAATGAGGAGCTGGTCCTTTTCCTGTCCAAACACAGACACAAGAACTTCCTCAAGTCCCATGGGCGTGACAATGCTCGTTTTATAAAGAAACAGGGCCTGGACCGCCTTTTTCACGAATGCGACTCCCACATGTGGCGCCTTGGAGAGCGGCAGATCCCGGAGGGAATCGTGGTGGATGGAGGCTCGGACTGGTTCGCCCTGACACGAAACTTTGTGGAATACGTCACCTACACAAAAGATATCTTGGTCTCCGAACTGCGACGCTTTTACAAGTACACCCTTCTGCCTGCTGAGTCCTTCTTCCACACGGTCTTGGAAAACAGTAAAGCCTGTGACTCTCTGGTGGATAACAACCTGCGAGTGACCAACTGGAACAGGAAGCTGGGCTGCCGCTGTCAGTATAAGCACATCGTGGACTGGTGCGGCTGTTCTCCCAACGACTTCAAACCGCAGGATGTGGTGCGCCTTCAGCAGCTCTCCCGGCCTACGTTCTTTGCCCGGAAGTTTGAGTCGTCAGTGAATCAGGAGGTATTGGATATTTTGGATGCTCATCTGTTTGGGGAGCTCCCGTCAGAGACTCCTGGAATAAAGGGGTACTGGGAAAGCGTCTACGACAGCATTGATGGGCTTGGGGGGTTAAGTGATGTCACTATGACTGTGTACGCTGCGTTCACCCGTCTGGCGCTCCATGAACTACAGGGTTCCAAGAAGGAGACAAGGCAGCCATCTTGCTGGTTTACTGCTTCCGGGTTGCCGTCCAGTGTCGAGCTGTATTTTTACGACGACCATTTCCAAGGTTACCTTGTGAAGCAGGAGGTGCAGAGTGGGGAAACGCTGGAGATCTGGATGATGCCACAGGGCAGCCTGAAACTGTCAGAACAGGGCGAGGCTATAGGCCGCATACAGGGTCTTGAAGTGGGCACAGAGTGGGACCCTAAAGAGAGGATCTTCCGTAATTTTGGAGGCCTGATCGGACCCTTCGATGAGCCGGTGGCGGTACAAAAGTGGTCCCGTGGGCTCAATCTGACAGTAACAGTTGTTTGGATTGATCCCACATACATTATCGCCGCCTCTTATGACATCATTGTGGATATAGATGCCGATTTCACACAGTACAAGCCTCCGCTGGCTCGCCCTTTGCGTCCTGGCTATTGGACTGTTCGGCTCTTGCGCTTCTGGGAATTATTGGCTGAGGTTCGCTTCCTAGTGGTACCGCTGACCGTGAGAAACAAGGAGCCGCTGCGGAAAGGGGATAGATGGTTGCACGCAGGACCCCCAAAAGGGCAGTATATGGAGCAAAATTTCCAAGCTCTCGGCGGGATTTTGAACTTGCCCCCCCGAGTGGAGGCAGAACGAGAGGCTAAGGGCAAATCGGAGCTCCTCGGCAAAGAGCTAGAAGCGTGGACAGATGAAAGCTTAAGGAGCTTTTGGTCAGTCGGGGGCGTATGCACCAAGGATGCTTCCAAGTCCTGCCCCTCTCTTCCCGTATGCTCCGCCACACGCTGGAGCTCCATGTCCCCCGATCCAAAGTCAGAGCTGGGCCCTGTCACACACGATGGCCGCGTGAGGTAA
Full Trace Sequence: atggcgaccatttttgagtcgggtaggagaactcactggcattaagggaacgcaggaaactaaggtggtctccgagggcgtttgtggggtgtgtaccctcggcccacctcccgctcacacaggggctcacggatagccaagcccgtatccctaggggggccctgggaggatggcgccaagcgtacggggactgaagctcggccgccgatacaaactgttagccggagccgcgctggtactgctgctcatacagggcctggcggtgtggagcttcagcgggctggagggggacgggaaggagaattccctgccaagggtaaatagaagcccagataatggagaagtcgccaaggactcagacagttctgcagggagtaggtcgcagagatggacggtaagaccagaaagaaggagcagcgatgggagcaagataacaagaaaggccacggtaacccgcaaacagaggccgccggcccaagtcttccatgggaattggcacaatctcacccgagagggggacacgggcagtgtggagggggcacctcaccaatcagaccgtggcttcactccgaagtgtgagatcacaggaaaggatgccctctccgctctcgccagagctagaacccaccagtgccaacaggagatcgctaacttggtgtgccttcaccaggcgggagagcttatgccaagaaatgtccaacggcagtgccaaaccacaggaaaggttaacacaggcttaacatgggaggagtcagatgcggttgctccaccccctgaaaagcctttacgtgtgttgtatatgctggtcgtgcacggcagagctatacggcaattgaaacgtctcatcaaggccatttaccatcaagatcacttctactacatccacgtggatcagcgatccaactaccttcaccgggaagtggtccgcctagcgcagtcatatgagaatatgcgcgtcaccccttggcgcatggtgaccatatggggaggagccagccttctgaccatgtatctacgcagcatgaaggacctgctggaggtgcccgactggccttgggacttctttatcaacttgagtgccactgactaccctacaaggaccaatgaggagctggtccttttcctgtccaaacacagacacaagaacttcctcaagtcccatgggcgtgacaatgctcgttttataaagaaacagggcctggaccgcctttttcacgaatgcgactcccacatgtggcgccttggagagcggcagatcccggagggaatcgtggtggatggaggctcggactggttcgccctgacacgaaactttgtggaatacgtcacctacacaaaagatatcttggtctccgaactgcgacgcttttacaagtacacccttctgcctgctgagtccttcttccacacggtcttggaaaacagtaaagcctgtgactctctggtggataacaacctgcgagtgaccaactggaacaggaagctgggctgccgctgtcagtataagcacatcgtggactggtgcggctgttctcccaacgacttcaaaccgcaggatgtggtgcgccttcagcagctctcccggcctacgttctttgcccggaagtttgagtcgtcagtgaatcaggaggtattggatattttggatgctcatctgtttggggagctcccgtcagagactcctggaataaaggggtactgggaaagcgtctacgacagcattgatgggcttggggggttaagtgatgtcactatgactgtgtacgctgcgttcacccgtctggcgctccatgaactacagggttccaagaaggagacaaggcagccatcttgctggtttactgcttccgggttgccgtccagtgtcgagctgtatttttacgacgaccatttccaaggttaccttgtgaagcaggaggtgcagagtggggaaacgctggagatctggatgatgccacagggcagcctgaaactgtcagaacagggcgaggctataggccgcatacagggtcttgaagtgggcacagagtgggaccctaaagagaggatcttccgtaattttggaggcctgatcggacccttcgatgagccggtggcggtacaaaagtggtcccgtgggctcaatctgacagtaacagttgtttggattgatcccacatacattatcgccgcctcttatgacatcattgtggatatagatgccgatttcacacagtacaagcctccgctggctcgccctttgcgtcctggctattggactgttcggctcttgcgcttctgggaattattggctgaggttcgcttcctagtggtaccgctgaccgtgagaaacaaggagccgctgcggaaaggggatagatggttgcacgcaggacccccaaaagggcagtatatggagcaaaatttccaagctctcggcgggattttgaacttgcccccccgagtggaggcagaacgagaggctaagggcaaatcggagctcctcggcaaagagctagaagcgtggacagatgaaagcttaaggagcttttggtcagtcgggggcgtatgcaccaaggatgcttccaagtcctgcccctctcttcccgtatgctccgccacacgctggagctccatgtcccccgatccaaagtcagagctgggccctgtcacacacgatggccgcgtgaggtaacactttctgcaggcagagagcacggacttggacagatggcgccacttagactgatgggacacggagccactcatatcatggcacacaatcacctggccagtcagctccttgtttgtctgccccgctgggagttgctagaatgtaataatctactctccagagaacaagatggaagccttactctgcctcatagccacgcccagcgccgacgttgtaccccaaatgcacacaattctgttacgtgtggtcccctctgtctttccatttcatccccgtgtgccaaacgtgtttttaacgggagggacgtttccgctgctacaagaacaaacaaccaaatactacatgggggtgtggtttgtatggtgtggggctcgtcgtcgttaaaggagccccgacttaaattaccctggtggggctggttcccccccagggagtgatccgtttgacctctgttatttcatattcgattgtgtaaccacttgtggcccactattacgacgcttccggtgaagtaagagatcactgtggattcaaatgctgaaatcacaaccactatggcaacaccactgtggttttgtgcagttgcttccccagcacaggctggttccagactctcacaaagggattaagctactttgtttactggggaggtccgctgctagggcgaatggtacgggacatacaagaaccaaatgtagcctgtgtattgcagcctcctgtgtgccaggcagctgggaagcacagggcacaatgatgcactttaagtttattttgtttccttgagtgacattggtcttaataaatgggttattgtaaccactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MAPSVRGLKLGRRYKLLAGAALVLLLIQGLAVWSFSGLEGDGKENSLPRVNRSPDNGEVAKDSDSSAGSRSQRWTVRPERRSSDGSKITRKATVTRKQRPPAQVFHGNWHNLTREGDTGSVEGAPHQSDRGFTPKCEITGKDALSALARARTHQCQQEIANLVCLHQAGELMPRNVQRQCQTTGKVNTGLTWEESDAVAPPPEKPLRVLYMLVVHGRAIRQLKRLIKAIYHQDHFYYIHVDQRSNYLHREVVRLAQSYENMRVTPWRMVTIWGGASLLTMYLRSMKDLLEVPDWPWDFFINLSATDYPTRTNEELVLFLSKHRHKNFLKSHGRDNARFIKKQGLDRLFHECDSHMWRLGERQIPEGIVVDGGSDWFALTRNFVEYVTYTKDILVSELRRFYKYTLLPAESFFHTVLENSKACDSLVDNNLRVTNWNRKLGCRCQYKHIVDWCGCSPNDFKPQDVVRLQQLSRPTFFARKFESSVNQEVLDILDAHLFGELPSETPGIKGYWESVYDSIDGLGGLSDVTMTVYAAFTRLALHELQGSKKETRQPSCWFTASGLPSSVELYFYDDHFQGYLVKQEVQSGETLEIWMMPQGSLKLSEQGEAIGRIQGLEVGTEWDPKERIFRNFGGLIGPFDEPVAVQKWSRGLNLTVTVVWIDPTYIIAASYDIIVDIDADFTQYKPPLARPLRPGYWTVRLLRFWELLAEVRFLVVPLTVRNKEPLRKGDRWLHAGPPKGQYMEQNFQALGGILNLPPRVEAEREAKGKSELLGKELEAWTDESLRSFWSVGGVCTKDASKSCPSLPVCSATRWSSMSPDPKSELGPVTHDGRVR
Donor tissue: gastrula