ORFeome > ykt6 – XORFeome 2.0

ykt6 – XORFeome 2.0

General Information

Species: Xenopus tropicalis YKT6 v-SNARE homolog (S. cerevisiae), mRNA (cDNA clone MGC:76008 IMAGE:5384620), complete cds
Gene Symbol: ykt6
Gene ID: 394619
ORF gb_acc: MG133462
ORF ID: 10983

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061415

Library Location

Plate ID: GDExt11009
Well Location: G07

EST Sequences

Clone: MGC:76008 IMAGE:5384620
Trimmed Sequence: ATGAAGCTTTACAGTCTCAGTGTTCTATATAAGGGAGATAACAAGGTCAGTCTTCTGAAAAGTGCCTATGATGTCTCCTCCTTCAGCTTCTTCCAGAGATCCAGCATCCAGGAGTTTATGGCATTTACCAGCCAGCTGATAGTGGAACGATCAGATAAAGGGAGCCGGTCCTCTGTGAAGGAGCAAGAATACCTGTGCCATGTGTATGTACGAAACGACTCCCTAGCTGGGGTGGTGATTGCTGATAATGAGTACCCTCCAAGAGTCTGCTTCACCCTTCTTGAAAAAGTACTTGAAGAGTTCTCCACTCAAGTGGACAGGATAGACTGGCCATCAGGCTCCCCTGCCACCATCCAGTACAACGCTTTGGACTCTTACCTTAGCAAGTATCAGAACCCTCGAGATGCAGATCCAATGAGTAAAGTACAGGCTGAGCTGGATGAGACCAAAATTATCCTGCACAACACCATGGAATCATTATTACAACGTGGAGAGAAACTGGATGACCTGGTCAGTAAATCTGAGGTCCTGGGGACACAGTCAAAGGCTTTCTACAAAACTGCACGGAAGCAGAACTCGTGCTGCGGCATCATGTGA
Full Trace Sequence: gtagcgacccgggactgttgggctgttgggaaaagcgggacttggtgctattattaaggctgtgtaggggagacgacacgcaggcacttcagcatccaacacccctcccgaagtctacatctcactgacagcaggggggccctgtgagccaaccaccatgaagctttacagtctcagtgttctatataagggagataacaaggtcagtcttctgaaaagtgcctatgatgtctcctccttcagcttcttccagagatccagcatccaggagtttatggcatttaccagccagctgatagtggaacgatcagataaagggagccggtcctctgtgaaggagcaagaatacctgtgccatgtgtatgtacgaaacgactccctagctggggtggtgattgctgataatgagtaccctccaagagtctgcttcacccttcttgaaaaagtacttgaagagttctccactcaagtggacaggatagactggccatcaggctcccctgccaccatccagtacaacgctttggactcttaccttagcaagtatcagaaccctcgagatgcagatccaatgagtaaagtacaggctgagctggatgagaccaaaattatcctgcacaacaccatggaatcattattacaacgtggagagaaactggatgacctggtcagtaaatctgaggtcctggggacacagtcaaaggctttctacaaaactgcacggaagcagaactcgtgctgcggcatcatgtgatggaagatcagacggcagaccaaatggacaccagacaatgaacaaacactataatatcaggggcagtgtcctgtcccccttttctgtaaggggtggtgaatataaacgctgctgccctggataagtccccgcccccttcaagtgttaacgagggacagtttttttgtttttttatgttgtctgtgatgtgtgtcagatttatattacaagacccccctcccctgattcccccccccatcccatacacaagttggcatacctccgtacctggaggcatgatctgaacagtgtaaccattcctttatctctaacaatactggctttctctatgcacagagtaaacgtgtgtgacgttgaatgttaatggcgagtattcccatatataagcagccttgccccaggctctggatctgatgcaggtagcacagaaacaaacaaagtcttaatttataatcatcctatggtgtgtaattatgctgcgtaattctgtgctctgggagatgtccttgttctttgtatgaaaatccctcagtgtgtgtccagctttaaacccataaacatggggcagggaacattttatatattgagggggggggggggggttcgagaaaatatatttcaatcccagagtcctcatcttgctgcagatacggtaacagattaaccctgctttcttgtcttttaacactctcctacctacaggagattctacatgattttctagttgtttttttaaccacttgttaaccagaggaatctccctatgctattaagtgtattacccaataaaagtacagggctcactgctctttgtttttgtaatggtgcttctcggctgaagcaatgccgtgactgtaagaacctcattcaccttgggacgtgcattaacccttttatactccagttcctgaatggttgaccaatgccaccagctgacatttcaggccactccagaagagtgaatgttcaatgcccacttgggggggcggcatacaaactgtatagataagttattattgtaactaattgttcgtttgttttactgattttctttttgtccccctctccattgatggttttcatgacccactttcaaaactgtattttaataaagattggctggacatttctgtatcaaaaaaaaaaaaaaaaa
Translation: MKLYSLSVLYKGDNKVSLLKSAYDVSSFSFFQRSSIQEFMAFTSQLIVERSDKGSRSSVKEQEYLCHVYVRNDSLAGVVIADNEYPPRVCFTLLEKVLEEFSTQVDRIDWPSGSPATIQYNALDSYLSKYQNPRDADPMSKVQAELDETKIILHNTMESLLQRGEKLDDLVSKSEVLGTQSKAFYKTARKQNSCCGIM
Donor tissue: neurula