ORFeome > ywhaq – XORFeome 2.0

ywhaq – XORFeome 2.0

General Information

Species: Xenopus tropicalis tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, theta polypeptide, mRNA (cDNA clone MGC:69491 IMAGE:5336305), complete cds
Gene Symbol: ywhaq
Gene ID: 594958
ORF gb_acc:
ORF ID: 11898

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC090612

Library Location

Plate ID: GDExt11019
Well Location: A02

EST Sequences

Clone: MGC:69491 IMAGE:5336305
Trimmed Sequence: ATGGACAGGAACGCGCAAATCCAGAAGGCCAAGCTAGCAGAGCAGGCTGAGCGTTACGATGACATGGCGGCTAGCATGAAAGCCGTAACAGAGTGCGGCACAGAGCTGTCCAGTGAAGAGAGAAATCTCCTTTCTGTTGCCTACAAGAATGTAGTGGGTGCAAGAAGATCTGCCTGGCGTGTCATCTCCAGCATTGAGCAGAAGTCAGACAGTGAAGAAACAAAGCTGAAGATTGCCAGAGAGTACAAAGAGAAAGTGGAGAGTGAGCTACAAAATATTTGCGAAACTGTTCTGAACCTGCTTGACAAGCACTTAATAAGCTCTTCAACTGCAACAGAAAGCCAGGTCTTTTACCTTAAAATGAAGGGTGATTACTATCGGTACCTAGCAGAGGTGGCAACTGGAGATAACCGAACTAAAACAATACAAGATTCACAAGCTGCCTATCAAGAGGCATTTGACATCAGCAAAAAGGACATGCAGCCAACACATCCCATTCGCTTGGGTTTAGCCTTGAATTTCTCCGTGTTTTATTATGAAATTCTCAATAGTCCAGAAAAGGCCTGTACACTCGCTAAAAACGCGTTTGATGAAGCCATCGCAGAACTCGATACCCTAAATGAAGAGTCTTACAAAGACAGCACCCTTATCATGCAGCTGCTTAGAGACAACCTAACATTATGGACATCGGATACCGCATGCGATGACAACGATGCTGTAGAGCAAGGAGAAAACAACTAA
Full Trace Sequence: gtgaggagcgcaaggttacagctgtctgcgcatcagattcacctagaacgcctcttgttgttggttggcagacttcaacttttccctcctttccacctatctgatttcctccctcagcacagccatggacaggaacgcgcaaatccagaaggccaagctagcagagcaggctgagcgttacgatgacatggcggctagcatgaaagccgtaacagagtgcggcacagagctgtccagtgaagagagaaatctcctttctgttgcctacaagaatgtagtgggtgcaagaagatctgcctggcgtgtcatctccagcattgagcagaagtcagacagtgaagaaacaaagctgaagattgccagagagtacaaagagaaagtggagagtgagctacaaaatatttgcgaaactgttctgaacctgcttgacaagcacttaataagctcttcaactgcaacagaaagccaggtcttttaccttaaaatgaagggtgattactatcggtacctagcagaggtggcaactggagataaccgaactaaaacaatacaagattcacaagctgcctatcaagaggcatttgacatcagcaaaaaggacatgcagccaacacatcccattcgcttgggtttagccttgaatttctccgtgttttattatgaaattctcaatagtccagaaaaggcctgtacactcgctaaaaacgcgtttgatgaagccatcgcagaactcgataccctaaatgaagagtcttacaaagacagcacccttatcatgcagctgcttagagacaacctaacattatggacatcggataccgcatgcgatgacaacgatgctgtagagcaaggagaaaacaactaaagtgagcaactggcacatctttattcccgaaccctttttacacgtctccattcctacgctccacgtggatttcttagagcaaaagaagcccatccatgtgtaatggaaatcaagtttatagtcttttcacactgcagctttggggaaattccattcctttttttttttttttttttcccccctcccttttaatgtgtccatccttctggtgtgtggttactgctgtagagaagtattaacagtttaacctcgtttaaaaacaacaaaaaaacaaatgagaattaaacataagtaacttggaacacttatgttgaggactgaaagcctgtgtggtatttaaataaaaaattggaactatgcttttcagaaaaaaatccttttttatatatatatggtaaaataaagcgtgagggaaatgtagttaactgttcaatccaaatatgtctgtcatatatatatttttttttattttcttgtagcttttaaagaccattttgccctgtgggggggggggggagaacaaacacaaaatgacggtggtaaattgccagttgttaccttccaattttaagaactacaaatgtcagacgtctggtgtactaccagatggataggaccctttattataaattgggctgccttttttttttttttttttgttgaaccagttttgcagttggcaagtgttaaacgtcatcatccatcagcggctcctgactgtttgtggataacttgactattttttccaatgtttgctgcttcagttgacaacatttgcctccttcagtaaatcaataaattgtcattacactcaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDRNAQIQKAKLAEQAERYDDMAASMKAVTECGTELSSEERNLLSVAYKNVVGARRSAWRVISSIEQKSDSEETKLKIAREYKEKVESELQNICETVLNLLDKHLISSSTATESQVFYLKMKGDYYRYLAEVATGDNRTKTIQDSQAAYQEAFDISKKDMQPTHPIRLGLALNFSVFYYEILNSPEKACTLAKNAFDEAIAELDTLNEESYKDSTLIMQLLRDNLTLWTSDTACDDNDAVEQGENN
Donor tissue: tailbud