ORFeome > zbtb8.2 – XORFeome 2.0

zbtb8.2 – XORFeome 2.0

General Information

Species: Xenopus tropicalis zinc finger and BTB domain containing 8, gene 2, mRNA (cDNA clone MGC:75883 IMAGE:5383139), complete cds
Gene Symbol: zbtb8.2
Gene ID: 394603
ORF gb_acc: MG133040
ORF ID: 10438

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC061347

Library Location

Plate ID: GDExt11004
Well Location: E12

EST Sequences

Clone: MGC:75883 IMAGE:5383139
Trimmed Sequence: ATGGATCTACCTTCACACCACTCTCGGCTGTTGCGGCAGCTGGATGAACAGAGAAGGAGGAACCTCTTTTGTGACTGTCATATCATGATTGATGGACATACATTCAGGGCCCATAGAAATGTTCTGTATGCAAGCAGTGGCTACTTCAAGATGCTCCTGTCCCAAAGCAGTGGGAATGTGGGCCAACCTACTACAGCCACTTTTGATGTCTTTTCTGCTGACACTTTCACAGCCATTCTTGATTTTATGTACTCCGGCAAGTTGAACCTCTCTGGCCAGAATGTCATTGAAATCATGTCAGCAGCCAGCTATTTACAAATGACCGAAGTTATTGGTGTTTGCAAAATGTTTATCAAATCCTCGCTGGACATCAATGAGAAGGACAGGGATGGTTTCTTAGACATTTCTGACAAAGAGACTGGACAGCAGACTGGACAATGTGGTCTTTACAGCACTGGCTGGGGCATGGGCAGATATCATTGTAATCAGCCAGAAGGGGATATTGCAGCATATTTAGAAACCAGCTCCTGTACTCCATATGGGTTTTGTTCTAGAACTGATGAACATCCCTCTTCCCAGAATAGCATTTCTACAGCAACCATGAAAATGTTAGACAGGCACAACAGGATACCCCAGATACCCAGCTCAACGTGTTCCCCAGAGGAACATTTGAGAGAGTGCAGAATTCTGGAATCAGATGACACTGGTTGTCACATTGAGGTAGAACTTCCCCAGGGGGAGGAGACAGAAGCTTTTTTGAACTGCCAGACAGTGGTGCAACCAAGAAGTAGAAGGCGGCATTCTCTGAACAGGGCAACAAAAGCTGATGAAGTCTATGCCAAAATTATGGGCATCAAAGGCTGTTTAGGAGAAGATAATCTGCCAAGCTTGCACTTCAAGTGCCCTTTTTGTACCCATACGGTTAAAAGGAAAGCAGATCTAAAACGCCACCTGCTGTGCCACACTGGTGAGCGTCCATATCCTTGCCAAGCCTGTGGCAAGAGATTCACCAGGTTGGAGCATGTCCGCAGTCATTATCGAACTATTCATGAAGCAGGGAAGCCTATATGCCGGTGGTGCAAGCGCCATGTTACTGAGGATTCAGGTCAAGTGGTTCAAGAAGGGACAAGACGTTTCCGATTGTGCAACAAGTGTGTGGCAGAGGTTGGGGTTGGTAGCTTTCCAAATGAGGTGGATGATGATGAACCCACTATTATCCTGTCAGGTGATGAGGACAAGGAACCAACTTGGAACTTCCATGATGGGATACAGACATCAGATCCAGAGATTATAGAGGATGTCTCCTCTGATGTAGTCATACATAAAGTGGATGATAGTGATGACGAAATCAAACCAATTATCTGCTAA
Full Trace Sequence: ggggaaagcactacatgcaagcgggcgatcggctgaaaaaaaggacaaaacacccaactacggtctataggctgtttctggctgcaagatggatctaccttcacaccactctcggctgttgcggcagctggatgaacagagaaggaggaacctcttttgtgactgtcatatcatgattgatggacatacattcagggcccatagaaatgttctgtatgcaagcagtggctacttcaagatgctcctgtcccaaagcagtgggaatgtgggccaacctactacagccacttttgatgtcttttctgctgacactttcacagccattcttgattttatgtactccggcaagttgaacctctctggccagaatgtcattgaaatcatgtcagcagccagctatttacaaatgaccgaagttattggtgtttgcaaaatgtttatcaaatcctcgctggacatcaatgagaaggacagggatggtttcttagacatttctgacaaagagactggacagcagactggacaatgtggtctttacagcactggctggggcatgggcagatatcattgtaatcagccagaaggggatattgcagcatatttagaaaccagctcctgtactccatatgggttttgttctagaactgatgaacatccctcttcccagaatagcatttctacagcaaccatgaaaatgttagacaggcacaacaggataccccagatacccagctcaacgtgttccccagaggaacatttgagagagtgcagaattctggaatcagatgacactggttgtcacattgaggtagaacttccccagggggaggagacagaagcttttttgaactgccagacagtggtgcaaccaagaagtagaaggcggcattctctgaacagggcaacaaaagctgatgaagtctatgccaaaattatgggcatcaaaggctgtttaggagaagataatctgccaagcttgcacttcaagtgccctttttgtacccatacggttaaaaggaaagcagatctaaaacgccacctgctgtgccacactggtgagcgtccatatccttgccaagcctgtggcaagagattcaccaggttggagcatgtccgcagtcattatcgaactattcatgaagcagggaagcctatatgccggtggtgcaagcgccatgttactgaggattcaggtcaagtggttcaagaagggacaagacgtttccgattgtgcaacaagtgtgtggcagaggttggggttggtagctttccaaatgaggtggatgatgatgaacccactattatcctgtcaggtgatgaggacaaggaaccaacttggaacttccatgatgggatacagacatcagatccagagattatagaggatgtctcctctgatgtagtcatacataaagtggatgatagtgatgacgaaatcaaaccaattatctgctaaccacacaggaatgtattgttcacaaacatcccaaaactgtagagctgttgaataaccaagatgaaacacctgcacaaatcactgagactgccatttatattgtttgtattcactgagatttactgaatgcataagacacttgcctattttctgcaaatcttgaatttaaacttgtgaattgcttgaatttgcagtcatttttagatcaaataataaaagaaaaatgagcgaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MDLPSHHSRLLRQLDEQRRRNLFCDCHIMIDGHTFRAHRNVLYASSGYFKMLLSQSSGNVGQPTTATFDVFSADTFTAILDFMYSGKLNLSGQNVIEIMSAASYLQMTEVIGVCKMFIKSSLDINEKDRDGFLDISDKETGQQTGQCGLYSTGWGMGRYHCNQPEGDIAAYLETSSCTPYGFCSRTDEHPSSQNSISTATMKMLDRHNRIPQIPSSTCSPEEHLRECRILESDDTGCHIEVELPQGEETEAFLNCQTVVQPRSRRRHSLNRATKADEVYAKIMGIKGCLGEDNLPSLHFKCPFCTHTVKRKADLKRHLLCHTGERPYPCQACGKRFTRLEHVRSHYRTIHEAGKPICRWCKRHVTEDSGQVVQEGTRRFRLCNKCVAEVGVGSFPNEVDDDEPTIILSGDEDKEPTWNFHDGIQTSDPEIIEDVSSDVVIHKVDDSDDEIKPIIC
Donor tissue: neurula