ORFeome > znf534 – XORFeome 2.0

znf534 – XORFeome 2.0

General Information

Species: Xenopus tropicalis zinc finger protein 534, mRNA (cDNA clone MGC:89393 IMAGE:6989417), complete cds
Gene Symbol: znf534
Gene ID: 448416
ORF gb_acc: MG133875
ORF ID: 11459

ORF full-length analysis tests

Clone type: Putative Full Length
XGC accession: BC075511

Library Location

Plate ID: GDExt11015
Well Location: C01

EST Sequences

Clone: MGC:89393 IMAGE:6989417
Trimmed Sequence: ATGGACAAGTATCTCCTGAGCCAAGTTCCTCTGCATATTCTGTCTGACAAGAAGTATCGGAGGGAAAGTGCCTCTGTTGTGGATGAATTCTTTGAAGCAGAGAAGCCACAGGCCCCGTACAGTGTAAACATCAATGTTATCCTGCCTGATACAGCTCATCTTCGTACAGGTCTCTATCGGCCATCCAAGACTTTCACTGTTCTCCCTCAAGTGAAAACAGAGCCAGGCAGCAACTTTGCACAGCCATGCTCTGCATCCTTGACCCAGACTCTCCCAGATTTCACAAGTGTGTTCAGTATGCCCCACTCTGTTGCAGTTAATAACATTTTCATCAAACAGGAGGCCCCTTCAGAAGTCCCTCTTTCAGCGCCTGCCTCTATCCAACCTCAGGTCTATCCTATGTCCATGGCCAATGAAACGCTGAGCTTGGCCCAGTCTAGTGGAACCACATCTGTAGTAAATTCCATCAGTGGAGTAACTATGGCAACACACAATGGTGGCCCCTCTCCTTTGCCCCAACCTGCAAGGATTCAGCAAGTCAAGCAATACCAGACCCTGGGGCAAGATGTTGTTCCAGTTTCCGGGCAGTTTTATCACTCTCCAGGTGTCTCGCTTCCACCTTCACCCCCAAATTCACAACCAGGAAGCCCTGAAAATCAGCCAGAGTTGATGAACACAATTTCACCCCCTCCATCATATGAGGCCACATTTGGACTGAAACTAGTGCAACCTCAACATATTCACACTGTGCCCAGCTCAATGGTGTCTGTGCTACCACAAGGGCAGGTGATCATGACAGTACCCAAATACAACAGACGGAATAATCCTGAACTCGAAAAGAGAAGAATCCATCACTGTGATTTCCCAGGTTGCTCAAAAGTCTACACCAAGAGTTCACACCTCAAGGCACACCAACGGACACATACAGGAGAGAAGCCATATAAATGTGCCTGGGAGGGCTGTGACTGGCGCTTTGCCCGTTCGGACGAGTTGACGAGGCACTACCGCAAGCATACAGGTGCCAAACCCTTCAAATGTGCCGCCTGTGGGCGCTGCTTTTCTCGCTCCGACCACCTCGCTCTGCACATGAAGAGGCATCAAAACTAG
Full Trace Sequence: caagggtccccactgactgtacagctttatccaggtatccatcagaagggagaaggcaaggtgcaggggtctaggcatgaccctacaaaccagcccaagcgagagcgctgtgtattcccagttaaaaccagtaaacatgtctgtggagggtgtggaagacagcggtgtgtttgaggatatcaaacctgctataaggatgctggcaagtcagccggagctcagcgagcatgaaagagcagaaatggacaagtatctcctgagccaagttcctctgcatattctgtctgacaagaagtatcggagggaaagtgcctctgttgtggatgaattctttgaagcagagaagccacaggccccgtacagtgtaaacatcaatgttatcctgcctgatacagctcatcttcgtacaggtctctatcggccatccaagactttcactgttctccctcaagtgaaaacagagccaggcagcaactttgcacagccatgctctgcatccttgacccagactctcccagatttcacaagtgtgttcagtatgccccactctgttgcagttaataacattttcatcaaacaggaggccccttcagaagtccctctttcagcgcctgcctctatccaacctcaggtctatcctatgtccatggccaatgaaacgctgagcttggcccagtctagtggaaccacatctgtagtaaattccatcagtggagtaactatggcaacacacaatggtggcccctctcctttgccccaacctgcaaggattcagcaagtcaagcaataccagaccctggggcaagatgttgttccagtttccgggcagttttatcactctccaggtgtctcgcttccaccttcacccccaaattcacaaccaggaagccctgaaaatcagccagagttgatgaacacaatttcaccccctccatcatatgaggccacatttggactgaaactagtgcaacctcaacatattcacactgtgcccagctcaatggtgtctgtgctaccacaagggcaggtgatcatgacagtacccaaatacaacagacggaataatcctgaactcgaaaagagaagaatccatcactgtgatttcccaggttgctcaaaagtctacaccaagagttcacacctcaaggcacaccaacggacacatacaggagagaagccatataaatgtgcctgggagggctgtgactggcgctttgcccgttcggacgagttgacgaggcactaccgcaagcatacaggtgccaaacccttcaaatgtgccgcctgtgggcgctgcttttctcgctccgaccacctcgctctgcacatgaagaggcatcaaaactagacactgtgtctgctgcgcagtcaacaaggcagctgtaccaaagaacaaaaatgctctaaggaacagatgtgttaccaacgttaaactggtggaggcagtgtgtgtgtgtgtgtgtgtgtgtgtgcgtgtgtggtgtctgcatacaatgtataaacactctagaaattgctttagaggtggtttttatcacaaccatattgcaacatttggattgccttcacctcatatcttacagcaatggagatacacaaccaacaataaacacttacataacaattgtttttccattgagtggaagacttttctaatgagtacaaagccttgtcagtggaagaagccacacagcttgtcctcttcaggttcttcatctacaaatagccaataacaaagaacattgccttggatttgtttcctttcaatggacagaagcaatgattacccagtttctctagatttacttgtattagatataccatgacctggatgaatgaaaaaccttcatagacaatggacaggcgcctcatcagacactttcctattgttccaatgtcttccacagagtaaggcttccatctgatgggttacatgacttgagtggatcctatgacaagtggcttcacccaaggaacccgctgacacacactgcagtccgttcttccccattccgtgcacacgctgttctgcaacttgatgagattttttgttgtgtaaaaaatttttgaaactgactgtcaccttggcttgtgacttttgaactgcacttccagttccgacatggctctgtgacaatgaatacaatcatctgcaacatgaacaaaatgttctcttttcctcctaggggactggaagaagatttttagaaaaaaagaagctgcaaatttgagtattaattgtctggaactttgctggccaaagcacataatgcagtatattgtgccatatagactgtgtagctgtatatgagtatatgaggacaaggatcaggcgatcggttatccacactttaatatatatatatggatttattttctacaaccaatgctgggtaatgtggccctttaatggtttataacccctacagtgtagcagccaaaggatctatgtagatttgcactggttttaaatgacattttaatgtaaacaataagatactactcaataaaatgtttggtgctccttatggttgcatctttcatcctgccctttcgatatatatatatatatatatatgtgtggaattttatttggaccaccaaatagatctgccttcttttatatgatacattctctacaacacaccatgtttaacatgcactccatttaggccatcttcctcgatacatacttgtaattttttttatttaaaaaatctatcttgtgggcatcatctttttagactcccttcaaacgcaagcccatatctctatgcactaaaataaaaacctaggaccttcttttcaacctccctatactagactgatcttagtgggttccactgcatcgcaattggctttactctctacatattctcttgttctactaatgatctgtgtttactgatgctcaatgacgttcaacctcttttgtttgtatatatatttttttacagattgaaataaaaatatgtacattttttaatactttaaataaatatacaaataacaaaaaaaaaaaaaaaaaaaaaa
Translation: MDKYLLSQVPLHILSDKKYRRESASVVDEFFEAEKPQAPYSVNINVILPDTAHLRTGLYRPSKTFTVLPQVKTEPGSNFAQPCSASLTQTLPDFTSVFSMPHSVAVNNIFIKQEAPSEVPLSAPASIQPQVYPMSMANETLSLAQSSGTTSVVNSISGVTMATHNGGPSPLPQPARIQQVKQYQTLGQDVVPVSGQFYHSPGVSLPPSPPNSQPGSPENQPELMNTISPPPSYEATFGLKLVQPQHIHTVPSSMVSVLPQGQVIMTVPKYNRRNNPELEKRRIHHCDFPGCSKVYTKSSHLKAHQRTHTGEKPYKCAWEGCDWRFARSDELTRHYRKHTGAKPFKCAACGRCFSRSDHLALHMKRHQN
Donor tissue: gastrula