ORFeome > znf703 – XORFeome 2.0

znf703 – XORFeome 2.0

General Information

Species: Xenopus tropicalis zinc finger protein 703, mRNA (cDNA clone MGC:97785 IMAGE:6990003), complete cds
Gene Symbol: znf703
Gene ID: 595070
ORF gb_acc: MG134479
ORF ID: 12185

ORF full-length analysis tests

Clone type: Full Length
XGC accession: BC093467

Library Location

Plate ID: GDExt11021
Well Location: A12

EST Sequences

Clone: MGC:97785 IMAGE:6990003
Trimmed Sequence: ATGAACTGTTCTCCCCCTGGATCTAGCACAGACACAGAGCGACAGAGCAGCAGCAGCGGCACCCCGGTGGCCCCCCGCCCCACTCTCGCACCCACTCACCCCCTGCGCCAGGCTAATCGGCTGCCCATCAGGCTGCTCAAAATGCTGACGGCACATACCGGACATTTGCTGCACCCGGAGTACCTGCAGCCCCTCTCCTCCACCCCGGTCAGCCCCATAGAGCTGGATGCCAAGAAAAGCCCACTAGCTCTGCTGGCACAGACCTGCTCACAGATAGGGAAGCCGGATCCCCCTCCGTCCTCTAAGCTGAATTCTGTGACCTCCAGTGGACTGAGCGAAAAGGAGAGTGGGCGCAGCTCTTCTTTGAAACTGGGAGAGTCTCCTTTGGAGGATAAGTCTAGCTTCAAGCCGTACTCGAAGGGTGGGGAGTCCAGGAAGGAAAGTGGATCATCTTCTGGCGGCGCTGCAGACAAGGCCGGATTTAGGGTGCCCAGTGGTTCTTGCCAGCCTTTTCCTCATGCCCCATCTCCGTCCTCAAGGGTGAGCTCCCCTGGACAGCACTGTGATTCTAAAAATAATGAGAGCCAGGAGAAGAAAGAGCCTGAGGCAAACAAAGCCAACTCTGAGACCTCTCAAGTCAACCCTACTCTGACAAGGGCCAGTACCAGTAACTCTAGTGCCGAGTCCAGCCAAAGCGGGGATGTTACCCCTATCAGCAAAGCTGACCCTCCGTCTCTTGGATCAGGCCATGTGGCCCCTGTTTCTCCCTACAAACCTGGACATTCTGTCTTTCCTCTTCCACCATCTGGCATTGGATATCACGGATCCATCGTGGGGGCTTATGCAGGATACCCATCCCAGTTTGTCCCTGGGCTGGATCACACCAAAACAAGCCTTGTTGGAAACCAGCTGCCTGGAACTCTAGGTTTACCGGGTAAACCTCCCAGCTCCAGCCCTCTGACTGGTGCTTCGCCTCCTTCATTCATGCAAGGATTGTGCAGGGACCCATACTGCTTGAGCTACCACAATGCTTCCCATCTCGGCTCCAGCAGCTGTTCCACTTGTGTACATGACCCATCTGCCTTGAAATCTGGATACCCTTTAGTCTACCCCAGCCACCCTCTCCATTCAGTGCACACCACCTTGTCTTCCAGTGTCACTCCGTCGCTGCCTGGTCACCCCTTATACACTTACGGCTTTATGCTACCAAATGACCCAGTCCCCCACATATGCAACTGGGTGTCCGCCAGTGGACCTTGTGACAAAAGGTTTTCCACCTCAGAGGAACTTCTTGCTCACCTAAGGACCCACACAGCTTTGCCTGGAGCTGACAAACTTTTGGCTGGGTACCCTACATCCACTTTGGGTTCTGCTGCTTCCTGCCACCTTCACCTTCCTCCCGCCGGGCCTGGAAGCCCTAACACATTGCCAGGGTCTCTATCTTTACGGAGTCCACATTCTTTGGGACTAAGTAGGTACCATCCATATGGAAAGGGTCACCTGACAACACCAAGTGGCCTGCCATTGCCCTCATTACCAGCAGGATCCTACTACTCCCCATACGCATTATATGGACAGAGGCTAACATCAGCTTCAGCGCTAGGATACCAGTAA
Full Trace Sequence: gggaagggagcacaaggggaatctctgcgccctggtccatccctcctccaaatgaactgttctccccctggatctagcacagacacagagcgacagagcagcagcagcggcaccccggtggccccccgccccactctcgcacccactcaccccctgcgccaggctaatcggctgcccatcaggctgctcaaaatgctgacggcacataccggacatttgctgcacccggagtacctgcagcccctctcctccaccccggtcagccccatagagctggatgccaagaaaagcccactagctctgctggcacagacctgctcacagatagggaagccggatccccctccgtcctctaagctgaattctgtgacctccagtggactgagcgaaaaggagagtgggcgcagctcttctttgaaactgggagagtctcctttggaggataagtctagcttcaagccgtactcgaagggtggggagtccaggaaggaaagtggatcatcttctggcggcgctgcagacaaggccggatttagggtgcccagtggttcttgccagccttttcctcatgccccatctccgtcctcaagggtgagctcccctggacagcactgtgattctaaaaataatgagagccaggagaagaaagagcctgaggcaaacaaagccaactctgagacctctcaagtcaaccctactctgacaagggccagtaccagtaactctagtgccgagtccagccaaagcggggatgttacccctatcagcaaagctgaccctccgtctcttggatcaggccatgtggcccctgtttctccctacaaacctggacattctgtctttcctcttccaccatctggcattggatatcacggatccatcgtgggggcttatgcaggatacccatcccagtttgtccctgggctggatcacaccaaaacaagccttgttggaaaccagctgcctggaactctaggtttaccgggtaaacctcccagctccagccctctgactggtgcttcgcctccttcattcatgcaaggattgtgcagggacccatactgcttgagctaccacaatgcttcccatctcggctccagcagctgttccacttgtgtacatgacccatctgccttgaaatctggataccctttagtctaccccagccaccctctccattcagtgcacaccaccttgtcttccagtgtcactccgtcgctgcctggtcaccccttatacacttacggctttatgctaccaaatgacccagtcccccacatatgcaactgggtgtccgccagtggaccttgtgacaaaaggttttccacctcagaggaacttcttgctcacctaaggacccacacagctttgcctggagctgacaaacttttggctgggtaccctacatccactttgggttctgctgcttcctgccaccttcaccttcctcccgccgggcctggaagccctaacacattgccagggtctctatctttacggagtccacattctttgggactaagtaggtaccatccatatggaaagggtcacctgacaacaccaagtggcctgccattgccctcattaccagcaggatcctactactccccatacgcattatatggacagaggctaacatcagcttcagcgctaggataccagtaaatacaactcccaaactcatagactgtatatttatttactgtatgttagcttcaagctgggaatattaagtgcattatttacaagaacaattcaatggtatgcaaatattttgtgtccccactccccataaaaaaaccctctttcattatcagtctgtcttccacgacaaccttatttttctttcctttgtttcctctttattttttctttttccactttttacttttactatttcttttgtttgcattaaacgtacttcttttttttttttttttttcagtcctaccatttctttttcccattttgcgggggagaaacaaaattacaaaagaactcaacctcctttttgatttgtacagttctttaaaaaaaaaaaaagtgtatttttatgtaatgtattttcggcatggtgggagagggagggcgcagcagagaaaggaggaaacaaaaaacacctttttttttcttttttttttggtggatgtccaaaaaaatggcgaatcttattttgttaataaatgaaaactaaactaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Translation: MNCSPPGSSTDTERQSSSSGTPVAPRPTLAPTHPLRQANRLPIRLLKMLTAHTGHLLHPEYLQPLSSTPVSPIELDAKKSPLALLAQTCSQIGKPDPPPSSKLNSVTSSGLSEKESGRSSSLKLGESPLEDKSSFKPYSKGGESRKESGSSSGGAADKAGFRVPSGSCQPFPHAPSPSSRVSSPGQHCDSKNNESQEKKEPEANKANSETSQVNPTLTRASTSNSSAESSQSGDVTPISKADPPSLGSGHVAPVSPYKPGHSVFPLPPSGIGYHGSIVGAYAGYPSQFVPGLDHTKTSLVGNQLPGTLGLPGKPPSSSPLTGASPPSFMQGLCRDPYCLSYHNASHLGSSSCSTCVHDPSALKSGYPLVYPSHPLHSVHTTLSSSVTPSLPGHPLYTYGFMLPNDPVPHICNWVSASGPCDKRFSTSEELLAHLRTHTALPGADKLLAGYPTSTLGSAASCHLHLPPAGPGSPNTLPGSLSLRSPHSLGLSRYHPYGKGHLTTPSGLPLPSLPAGSYYSPYALYGQRLTSASALGYQ
Donor tissue: gastrula