ORFeome > aarsd1 ORF2 – XORFeome v1.0

aarsd1 ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aarsd1
Gene ID: 5787129
Gene Page ID: 5787114
ORF Xenbase ID: 17262609

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC124925
Original XGC clone length: 1239

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11085
Well Location: E01

Sequences - 5ʹ (forward) EST

Accession: JZ837545
dbEST ID: 79655247
Trimmed Sequence: ATGGCTTTCCACTGTCAGAGAGATTGTTATGCCACTGAGCTGCTGACTGAAGTGGTGTCCTGCCATCCTGCCCAATTTAAATTTGGAAAATGGAGGCAAGAAAAACACTGTGTCTGGGTTTAATGTTTTATTGAAAGACACTGTACTTTTTCCTGAAGGGGGAGGCCAGCCGGATGACAGAGGCTTCATTGGGGAGGTTCCCGTGCTTAGAGTAATCCGTCAAGGGCCCGATGCTGTGCATTTTGTGGCCTCACCTTTAGATCCTGCTACTGAGGTGCTTGTGAAAATAGACTGGAACAGGAGGTTTGATCACATGCAGCAGCATTCAGGTCAACACCTGGTAACAGCCATTGCAGACTCTTTGTATGGATTCAAAACAACGTCCTGGGACCTGGGACGACAGCACAGTGTAATTGAGCTGGATACTCCATTGGTGACCACAGAGCAGTTATAAGCTATAGAGAAGATTGCTAATCAGAAGATTCGTGAGCATGTTCCTGTCCGTGTAAGACTTATAACATTTGATGATCCTGAATTCGATATGGTAAAAAAACAATGCCCTTGCCGGATAAACATACTAACCCTCTGGCAGGTATCTATATTTAAATCCCTAGAGGCCAAAATGTGGGTAGGGGAGCCGGGGCGGGAGGGGTGCACCAGGGGCGCAAAAATAAGGGTGGGGGGGGCTGGGGT
Full Trace Sequence: GGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCCACTGTCAGAGAGATTGTTATGCCACTGAGCTGCTGACTGAAGTGGTGTCCTGCCATCCTGCCCAATTTAAATTTGGAAAATGGAGGCAAGAAAAACACTGTGTCTGGGTTTAATGTTTTATTGAAAGACACTGTACTTTTTCCTGAAGGGGGAGGCCAGCCGGATGACAGAGGCTTCATTGGGGAGGTTCCCGTGCTTAGAGTAATCCGTCAAGGGCCCGATGCTGTGCATTTTGTGGCCTCACCTTTAGATCCTGCTACTGAGGTGCTTGTGAAAATAGACTGGAACAGGAGGTTTGATCACATGCAGCAGCATTCAGGTCAACACCTGGTAACAGCCATTGCAGACTCTTTGTATGGATTCAAAACAACGTCCTGGGACCTGGGACGACAGCACAGTGTAATTGAGCTGGATACTCCATTGGTGACCACAGAGCAGTTATAAGCTATAGAGAAGATTGCTAATCAGAAGATTCGTGAGCATGTTCCTGTCCGTGTAAGACTTATAACATTTGATGATCCTGAATTCGATATGGTAAAAAAACAATGCCCTTGCCGGATAAACATACTAACCCTCTGGCAGGTATCTATATTTAAATCCCTAGAGGCCAAAATGTGGGTAGGGGAGCCGGGGCGGGAGGGGTGCACCAGGGGCGCAAAAATAAGGGTGGGGGGGGCTGGGGT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTCCACTGTCAGAGAGAT

Sequences - 3ʹ (reverse) EST

Accession: JZ837544
dbEST ID: 79655246
Trimmed Sequence: CTCCTGAGTTATTTCTACACTGCTGATAACCTTCTGCAACAGAACTTCAACCTCTGCCCTCTGGCTCATCTTATTTGCTTTGCCTTGAAAACGACCACACTTTCCTGCTCCTTTACCATCCAGGATTTCACAAACTCTGGGCCCAAATTTCTCAACAATCCCTGGTGGTCCAGCTAGAAGAAACAATCCAGAGGTCTTTTCATCCCCAATGGTAAGAAACAGAAGCGTGTCCTCTGTTCCAATCACATTAGCGATAATATTCATGAACTCATTATCCCCTTCTTTCCTGTGCAACGAGAAGAATTTTCCTCTGTCTGCTTTGCTCTTGAAGTTTTCTGCTGTAAGGACAGCAAGATCTCTCAGTAAGGTCAAGTTATTCTTTTGAAGGGCTTTGACAGATTTTTGCAGTTTATCTACTGCTTCAATGTGCTCCTCAGGCCCATTCTTTAACAGGGACGTTAAAGTCTTTTCAGTGTTGTAGCTTCGAGAAACGTATTTTAAGACTCTCTCTCCAGACAAAAATATTAAATTAGTCTTGTTCTTCTTTCCCTTTTCAATACCCAAAATCTTGATCATCTGTAAGTCGCTCAGGTTTCTGAACTGTGTCCCACAACACATGTTGGCATCAACGCCTTCCATAATCATTAATCCTCACTGGGCCAGCCAGGATCATCC
Full Trace Sequence: CGGGAATACGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTCCTGAGTTATTTCTACACTGCTGATAACCTTCTGCAACAGAACTTCAACCTCTGCCCTCTGGCTCATCTTATTTGCTTTGCCTTGAAAACGACCACACTTTCCTGCTCCTTTACCATCCAGGATTTCACAAACTCTGGGCCCAAATTTCTCAACAATCCCTGGTGGTCCAGCTAGAAGAAACAATCCAGAGGTCTTTTCATCCCCAATGGTAAGAAACAGAAGCGTGTCCTCTGTTCCAATCACATTAGCGATAATATTCATGAACTCATTATCCCCTTCTTTCCTGTGCAACGAGAAGAATTTTCCTCTGTCTGCTTTGCTCTTGAAGTTTTCTGCTGTAAGGACAGCAAGATCTCTCAGTAAGGTCAAGTTATTCTTTTGAAGGGCTTTGACAGATTTTTGCAGTTTATCTACTGCTTCAATGTGCTCCTCAGGCCCATTCTTTAACAGGGACGTTAAAGTCTTTTCAGTGTTGTAGCTTCGAGAAACGTATTTTAAGACTCTCTCTCCAGACAAAAATATTAAATTAGTCTTGTTCTTCTTTCCCTTTTCAATACCCAAAATCTTGATCATCTGTAAGTCGCTCAGGTTTCTGAACTGTGTCCCACAACACATGTTGGCATCAACGCCTTCCATAATCATTAATCCTCACTGGGCCAGCCAGGATCATCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTGAGTTATTTCTACACTG