ORFeome > acy3 ORF1 – XORFeome v1.0

acy3 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: acy3
Gene ID: 6252462
Gene Page ID: 5934781
ORF Xenbase ID: 17263149

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC125990
Original XGC clone length: 918

Human orthology & disease relationships

NCBI Entrez ID: 91703
Ensembl gene IDs: ENSG00000132744
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 207800,207900,215700,311250

Library Location

Plate ID: GDExl11088
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ838206
dbEST ID: 79655908
Trimmed Sequence: ATGAGCCCCCCTGTGTCCCAAGTGGTGGTTGTTGGCGGAACACACGGCAATGAGATGTCGGGAGTCTGTCTGGCTAAACATTGGCTTCAGGACCCTTCAGAACTACGTAGAAAATCCTTTACAGCTGATATATTGTTAGCAAATCCTATTGCAGTGGAACGCTGTGTACGTTATATAGACAGGGACCTCAATCGTTCCTTTTCACATGAACTCCTAAGTGCCTCAGCTTCGGAAAGTGATTCTTATGAGGTAAAACGGGCGAGGGAGATATATCAGAAGTATGGACCAAAGCAATCTTCTTTAAATTTTGTTATTGACCTTCACAACACAACCTCCAATATGGGTACAACGATACTACTCTTTAAGGGAGACAATTTTGCATTGCACTTGGCAAACTACTTGAAGACTAAATGTGTTGATCCTTCTTTCCCATGTCACATCCTCCTCATTGACATACCAGAACAAGGGCATGTTCATCTGCAGAGCATGGGAAAGCATTCGATAAGTTTGGAGCTAGGCCCACAGCCTCAAGGAGTAGTAAGAACAGATGTTCTTGCAAGAATGAAGGTGCTTGTGAACAGCAGCTTGGATTTTCTTGACCTGTTTAACCAGGGCACAGAGTTTCCCAGTTTTTAAGCAGAATTGCACCAAGTTTTGCACAAGGCTGATTTTCCTCCGCGGTGCAAAAGGTGAAATAAAAGCCCTTTAACCCCCTCCAATTTCCAGGAAAAAAAACAATCTTCCCTTTAAGACCACGGTTAACCCCCATTTTCCCAAAGGCCTTAAATGGAAATGGAGAAAATGTTGGAAAAATTTGA
Full Trace Sequence: CTCGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAGCCCCCCTGTGTCCCAAGTGGTGGTTGTTGGCGGAACACACGGCAATGAGATGTCGGGAGTCTGTCTGGCTAAACATTGGCTTCAGGACCCTTCAGAACTACGTAGAAAATCCTTTACAGCTGATATATTGTTAGCAAATCCTATTGCAGTGGAACGCTGTGTACGTTATATAGACAGGGACCTCAATCGTTCCTTTTCACATGAACTCCTAAGTGCCTCAGCTTCGGAAAGTGATTCTTATGAGGTAAAACGGGCGAGGGAGATATATCAGAAGTATGGACCAAAGCAATCTTCTTTAAATTTTGTTATTGACCTTCACAACACAACCTCCAATATGGGTACAACGATACTACTCTTTAAGGGAGACAATTTTGCATTGCACTTGGCAAACTACTTGAAGACTAAATGTGTTGATCCTTCTTTCCCATGTCACATCCTCCTCATTGACATACCAGAACAAGGGCATGTTCATCTGCAGAGCATGGGAAAGCATTCGATAAGTTTGGAGCTAGGCCCACAGCCTCAAGGAGTAGTAAGAACAGATGTTCTTGCAAGAATGAAGGTGCTTGTGAACAGCAGCTTGGATTTTCTTGACCTGTTTAACCAGGGCACAGAGTTTCCCAGTTTTTAAGCAGAATTGCACCAAGTTTTGCACAAGGCTGATTTTCCTCCGCGGTGCAAAAGGTGAAATAAAAGCCCTTTAACCCCCTCCAATTTCCAGGAAAAAAAACAATCTTCCCTTTAAGACCACGGTTAACCCCCATTTTCCCAAAGGCCTTAAATGGAAATGGAGAAAATGTTGGAAAAATTTGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCCCCCTGTGTCCCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ838205
dbEST ID: 79655907
Trimmed Sequence: ATTCTGGAGCTTGAGAGCCGGGACAAAGCAGTGCTTTTTTTCAGTTGCAATGAAAGCAACTTTTTTTTCATAATATGCTGATTCATTTATAAATACAGGATAGATTAGTTTCTCTCCATTGTACAATATGTCATCTCCATTCAGCCTTTGGAAAATGGGATCACCTGGCTTTAGAGGAAGATAGTCTTTGTCCTGCAACTCTGAGTGGATAAAGGCCTGTATTTCACCATCTGCACCGCGAGGGAAATCAGCCTTGTGCAAAACTTGGTGCACTTCTGCTTCAAAACTGGGAAACTCTGTGCCCTGGTTAAACAGGTCAAGAAAATCCAAGCTGCTGTTCACAAGCACCTTCATTCTTGCAAGAACATCTGTTCTTACTACTCCTTGAGGCTGTGGGCCTAGCTCCAAACTTATCGAATGCTTTCCCATGCTCTGCAGATGAACATGCCCTTGTTCTGGTATGTCAATGAGGAGGATGTGACATGGGAAAGAAGGATCAACACATTTAGTCTTCAAGTAGTTTGCCAAGTGCAATGCAAAATTGTCTCCCTTAAAGAGTAGTATCGTTGTACCCTAATTGGAGGTTGTGGTTGTGAGGGTCAATAGAAAAATTTAAAGAAGAAATGCTTTGGTCCAAACCTTCTGATATATCTTCCCCCCCCCTTTTTTCCCCTAAAAAATCATTTTCCCAAACCTGAAAGGCATTTAGGAAGTTCGGGTAAAAGGGAGACGAAGTGGAGGGTCCCGGTCCGTTGGAAGGGTAAAACAAAAGGTTCCGCGT
Full Trace Sequence: GGGAAAATGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATTCTGGAGCTTGAGAGCCGGGACAAAGCAGTGCTTTTTTTCAGTTGCAATGAAAGCAACTTTTTTTTCATAATATGCTGATTCATTTATAAATACAGGATAGATTAGTTTCTCTCCATTGTACAATATGTCATCTCCATTCAGCCTTTGGAAAATGGGATCACCTGGCTTTAGAGGAAGATAGTCTTTGTCCTGCAACTCTGAGTGGATAAAGGCCTGTATTTCACCATCTGCACCGCGAGGGAAATCAGCCTTGTGCAAAACTTGGTGCACTTCTGCTTCAAAACTGGGAAACTCTGTGCCCTGGTTAAACAGGTCAAGAAAATCCAAGCTGCTGTTCACAAGCACCTTCATTCTTGCAAGAACATCTGTTCTTACTACTCCTTGAGGCTGTGGGCCTAGCTCCAAACTTATCGAATGCTTTCCCATGCTCTGCAGATGAACATGCCCTTGTTCTGGTATGTCAATGAGGAGGATGTGACATGGGAAAGAAGGATCAACACATTTAGTCTTCAAGTAGTTTGCCAAGTGCAATGCAAAATTGTCTCCCTTAAAGAGTAGTATCGTTGTACCCTAATTGGAGGTTGTGGTTGTGAGGGTCAATAGAAAAATTTAAAGAAGAAATGCTTTGGTCCAAACCTTCTGATATATCTTCCCCCCCCCTTTTTTCCCCTAAAAAATCATTTTCCCAAACCTGAAAGGCATTTAGGAAGTTCGGGTAAAAGGGAGACGAAGTGGAGGGTCCCGGTCCGTTGGAAGGGTAAAACAAAAGGTTCCGCGT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCTGGAGCTTGAGAGCC