ORFeome > adc ORF1 – XORFeome v1.0

adc ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: adc
Gene ID: 6493979
Gene Page ID: 6454419
ORF Xenbase ID: 17263215

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC047954
Original XGC clone length: 1371

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11013
Well Location: D01

Sequences - 5ʹ (forward) EST

Accession: JZ824053
dbEST ID: 79641755
Trimmed Sequence: ATGCAAGGGTATATCCAGGAGTCAGATTTTACCTTGGTTGAAGAAGGCTTTTTGGCCAGAGACTTGATGGAGGAAATCATTAATGAAGTCTCACAGACTGAGGATCGTGATGCCTTTTTTGTGGCTGATCTAGGGGATGTGGTAAGGAAACATCTCCGTTTTCTGAAAGCCTTGCCTCGTGTGAAGCCTTTCTATGCAGTGAAGTGTAACAGCAGCAAAGGAGTGGTGAAGATCTTGGCTGAGCTGGGAGCTGGATTTGACTGCGCCAGCAAGACAGAGATTGAGCTAGTCCAGGACATTGGTGTGGCACCAGAACGTATCATCTATGCCAACCCATGCAAACAGATTTCCCAGATTAAGTATGCAGCTAAGAATGGTGTCCAAATGATGACGTTTGACAATGAAGTAGAGCTTTCCAAGGTGTCAAGAAGCCATCCCAATGCAAGAATGGTTCTGCTGATAGCAACGGATGACTCTAAATCCTCTGCTCGTTTAAGTGTGAAATTTGGCGCCCCCTTAAAATCCTGCAGACGCTTATTGGAAATGGCTAAAAACCACAGTGTGGATGTCATTGGTGTTAGTTTCCACGTTGGTAGTGGATGCACTGATTCCAAGGCCTATACTCAGGCTATTTCTGATGCACGCTTGGTTTTTGAAATGGCATCTGAGTTTGGGTACAAAAGGTGGCTGCTGGATATTGGTGGTGGCTTCCCGGGAACCTAAGAATCCCCAAATTAGATTTGAGGAAATTGGCTGGGTGTTAATAATTCCATCCTCTGGGACCTGG
Full Trace Sequence: GGGCCCTAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGCAAGGGTATATCCAGGAGTCAGATTTTACCTTGGTTGAAGAAGGCTTTTTGGCCAGAGACTTGATGGAGGAAATCATTAATGAAGTCTCACAGACTGAGGATCGTGATGCCTTTTTTGTGGCTGATCTAGGGGATGTGGTAAGGAAACATCTCCGTTTTCTGAAAGCCTTGCCTCGTGTGAAGCCTTTCTATGCAGTGAAGTGTAACAGCAGCAAAGGAGTGGTGAAGATCTTGGCTGAGCTGGGAGCTGGATTTGACTGCGCCAGCAAGACAGAGATTGAGCTAGTCCAGGACATTGGTGTGGCACCAGAACGTATCATCTATGCCAACCCATGCAAACAGATTTCCCAGATTAAGTATGCAGCTAAGAATGGTGTCCAAATGATGACGTTTGACAATGAAGTAGAGCTTTCCAAGGTGTCAAGAAGCCATCCCAATGCAAGAATGGTTCTGCTGATAGCAACGGATGACTCTAAATCCTCTGCTCGTTTAAGTGTGAAATTTGGCGCCCCCTTAAAATCCTGCAGACGCTTATTGGAAATGGCTAAAAACCACAGTGTGGATGTCATTGGTGTTAGTTTCCACGTTGGTAGTGGATGCACTGATTCCAAGGCCTATACTCAGGCTATTTCTGATGCACGCTTGGTTTTTGAAATGGCATCTGAGTTTGGGTACAAAAGGTGGCTGCTGGATATTGGTGGTGGCTTCCCGGGAACCTAAGAATCCCCAAATTAGATTTGAGGAAATTGGCTGGGTGTTAATAATTCCATCCTCTGGGACCTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAAGGGTATATCCAGGAGT

Sequences - 3ʹ (reverse) EST

Accession: JZ829363
dbEST ID: 79647065
Trimmed Sequence: GATGATGCTGGTGGCTGCAAAGGTACGAGTGAAGCACAAGGAATCAGAAATCTCCCAGCCACAAGACATAGGGGTGCACACATTTTCTTTCTCCTCGGTTTGCTGTAATCCTCTCTGCAGCAACTGAACAGCTTTCCAAGCAGCACGGGGCATGGCGTAATGTACTGGAGACTGCTGGAAACCATTGAAATTGGAAGATGCTGCTATGGTGTATGCACCCATATTCTCAAACAAAAGCCAGTCGCCAACATGAAGCTCAGGCAGCTGAACGCGCTCTGCAATCTGATCTAAGCCATCGCACGTGGGTCCCCAAAGGCTACTGGTGTATAATGGCTGATCTGGAGAAGGTTTCTTGTGGAGGATTGGTTTTGGATGAGCATGATCAAAGACCAAGCAATTAAAGGATCCATACACTCCATCATTAACATAATACATGATGCTTTTGCTGGACTCATTTTCCTCATCATCAGATACAGAGTGTTCCACTTCTTTCTTAGCAATAACGTTAACAGCCAATGAAAAAGCAGATGCTACGTAATATCTTCCTGGTTCAGCGATAATTTGCACGTCAGAGCTCTCAGGGAAATACATGTCCAGTGCTGGATTTATTACACCTGCAATCTCCTCAAATCTAATTTTGGAATCCTCTGTTTCAGGGAAGCCCCCACCCAAAATCCGCCAGCCACCATTTTGTACCCCAAATTCAGAATGCCTTTTCAAAAAACCAAGCCTGGCATCCAAAAAAAAACCCGGAATTTATG
Full Trace Sequence: CTGACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATGATGCTGGTGGCTGCAAAGGTACGAGTGAAGCACAAGGAATCAGAAATCTCCCAGCCACAAGACATAGGGGTGCACACATTTTCTTTCTCCTCGGTTTGCTGTAATCCTCTCTGCAGCAACTGAACAGCTTTCCAAGCAGCACGGGGCATGGCGTAATGTACTGGAGACTGCTGGAAACCATTGAAATTGGAAGATGCTGCTATGGTGTATGCACCCATATTCTCAAACAAAAGCCAGTCGCCAACATGAAGCTCAGGCAGCTGAACGCGCTCTGCAATCTGATCTAAGCCATCGCACGTGGGTCCCCAAAGGCTACTGGTGTATAATGGCTGATCTGGAGAAGGTTTCTTGTGGAGGATTGGTTTTGGATGAGCATGATCAAAGACCAAGCAATTAAAGGATCCATACACTCCATCATTAACATAATACATGATGCTTTTGCTGGACTCATTTTCCTCATCATCAGATACAGAGTGTTCCACTTCTTTCTTAGCAATAACGTTAACAGCCAATGAAAAAGCAGATGCTACGTAATATCTTCCTGGTTCAGCGATAATTTGCACGTCAGAGCTCTCAGGGAAATACATGTCCAGTGCTGGATTTATTACACCTGCAATCTCCTCAAATCTAATTTTGGAATCCTCTGTTTCAGGGAAGCCCCCACCCAAAATCCGCCAGCCACCATTTTGTACCCCAAATTCAGAATGCCTTTTCAAAAAACCAAGCCTGGCATCCAAAAAAAAACCCGGAATTTATG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGATGCTGGTGGCTG