ORFeome > aldh4a1 ORF1 – XORFeome v1.0

aldh4a1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: aldh4a1
Gene ID: 959465
Gene Page ID: 959459
ORF Xenbase ID: 17263845

ORF full-length analysis tests

Full-Length confidence: unknown
Original XGC clone accession: BC124987
Original XGC clone length: 1668

Human orthology & disease relationships

NCBI Entrez ID: 8659
Ensembl gene IDs: ENSG00000159423
Directly associated (OMIM) disease MIM numbers: 239510
Indirectly associated (Lage, et al.) disease MIM numbers: 230450,239510,606762,610015

Library Location

Plate ID: GDExl11084
Well Location: D08

Sequences - 5ʹ (forward) EST

Accession: JZ837574
dbEST ID: 79655276
Trimmed Sequence: ATGTTGCAGCTCCGCAGACTCCTCACTCGCTCCTGTGCCGGGTGGCGCCGGCATCATTGTGCAGCAGTGGAAGTAAAGAATGAGCCAATCCTGGATTTTAAACCTGGCAGCACGGAGAGGGCGGCCCTCCAGCAGTCATTACAGGAGCTGAAGGATAAAACAGAAGAAATCCCGTGTGTCGTGGGGGGAGAGGAGGTCTGGACTAAGGATGTGCGGTACCAAGTGTCGCCCTTCAAGCATTCTCACCGAGTGGCCAAGTACTGCTATGCGGATAAAAGAGCTGCAGAATAAAGCCATCAATGCGGCGCTGGCCGTGCGCAAGGAGTGGGACCTGAAACCCGTACAGGACCGGGCCCAGATCTTCTTTAAAGCAGCGGATCTTCTAAGTGGCCCCAGGAGGGCGGAGATTCTGGCCAAGACTATGATTGGGCAGGGGAAAACCGTGATCCAGGCAGAAATTGATGCAGCTGCTGAGTTAATCGACTTCTTCCGATTCAACGCCAAATACGCCATGGACCTGACGCACGAGCAGCCAATCAGCATCCCCGTCAGCACCAACTCCATGGTTTATAGAGGCTTAGAGGGGTTTATTGCCGCGGTGTCACCATTTAACTTCACTGGCATTGGTGGGAAATCTGGCGGGAGCTCCGGCACTGATGGGGGAAATGTGGTTCTTGGAAACCCCAGTGAAAACGCCCATGTTTGCCATTTTCCCCCTTTATCCAGGTTTCTGCGTGGAGGCCGGGCGTCCCGCCCCCCGTTCATCCAGCTTTATTCCTTTCCCTAAGGGTTCAGAAGCGTATGGGTGAACACTCTT
Full Trace Sequence: GGGGGCCAAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGTTGCAGCTCCGCAGACTCCTCACTCGCTCCTGTGCCGGGTGGCGCCGGCATCATTGTGCAGCAGTGGAAGTAAAGAATGAGCCAATCCTGGATTTTAAACCTGGCAGCACGGAGAGGGCGGCCCTCCAGCAGTCATTACAGGAGCTGAAGGATAAAACAGAAGAAATCCCGTGTGTCGTGGGGGGAGAGGAGGTCTGGACTAAGGATGTGCGGTACCAAGTGTCGCCCTTCAAGCATTCTCACCGAGTGGCCAAGTACTGCTATGCGGATAAAAGAGCTGCAGAATAAAGCCATCAATGCGGCGCTGGCCGTGCGCAAGGAGTGGGACCTGAAACCCGTACAGGACCGGGCCCAGATCTTCTTTAAAGCAGCGGATCTTCTAAGTGGCCCCAGGAGGGCGGAGATTCTGGCCAAGACTATGATTGGGCAGGGGAAAACCGTGATCCAGGCAGAAATTGATGCAGCTGCTGAGTTAATCGACTTCTTCCGATTCAACGCCAAATACGCCATGGACCTGACGCACGAGCAGCCAATCAGCATCCCCGTCAGCACCAACTCCATGGTTTATAGAGGCTTAGAGGGGTTTATTGCCGCGGTGTCACCATTTAACTTCACTGGCATTGGTGGGAAATCTGGCGGGAGCTCCGGCACTGATGGGGGAAATGTGGTTCTTGGAAACCCCAGTGAAAACGCCCATGTTTGCCATTTTCCCCCTTTATCCAGGTTTCTGCGTGGAGGCCGGGCGTCCCGCCCCCCGTTCATCCAGCTTTATTCCTTTCCCTAAGGGTTCAGAAGCGTATGGGTGAACACTCTT
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGCAGCTCCGCAGACTCC

Sequences - 3ʹ (reverse) EST

Accession: JZ837573
dbEST ID: 79655275
Trimmed Sequence: CTGCATATACGGGTACTTCCATTCCGTCAGGGGTACGTGGGTCTCTTTAATGACTTGCGGTGATGTCCATCTGAGGATGTAGTGCCGCCCCCCAGGCTTGTCATTGGTTCCAGAAGCTCGAGAGCCCCCAAAAGGCTGCTGAGCCACAACTGCGCCCGTGGATTTATCATTTACGTAGAAATTCCCTGCGGCGTGTCGGAGTATCTGTGTCGCCTCCCCCAGTACATTCTTGTCCTGAGCAAACACTGCCCCCGTGAGGCCGTATGGGGAGGTGGAGTCAATAAGGTGCAGGACTTCTCTGTAGTTGTTTTCCGGATAAACGTAAACCACCAGCACCGGCCCGAATATCTCCTCTTGAATGATCTTCTCCTTGGGGTTTTTGCTCTCAATGATGGTCGGTTCCACGAAATACCCCTCGCTGTCGTCACACTTCCCTCCTGCTAGAATGGTGAGCTCCGGGGAGGATTGCGCGTGTTTTATCCAACCCTCCATCCGCCTGAGAGACTTCTGATCGATGACAGCGGAGAAGAAGGTGGAGAAGTCGTTGGGGGTCCCCGTTTTTATCTTGGCCAGTTTCTCCAGGAACCCCGCTCTCATCCGGGCCCCATCGAGTCCGGAACGTAGAAGCGGAAACAAGCCCAAGCACTCCTGCCCCCCCAACTCAAAAGCCTGAACGGAACGGTCCCAGTTCCCCACACTCCTCCCAGTCCGCCCCAAACTTTGAAACAAAGGGGAAAGATTTCTTCCCCCTCAGAATTTCTCCCCTAAAAAATTC
Full Trace Sequence: AAAATTGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTGCATATACGGGTACTTCCATTCCGTCAGGGGTACGTGGGTCTCTTTAATGACTTGCGGTGATGTCCATCTGAGGATGTAGTGCCGCCCCCCAGGCTTGTCATTGGTTCCAGAAGCTCGAGAGCCCCCAAAAGGCTGCTGAGCCACAACTGCGCCCGTGGATTTATCATTTACGTAGAAATTCCCTGCGGCGTGTCGGAGTATCTGTGTCGCCTCCCCCAGTACATTCTTGTCCTGAGCAAACACTGCCCCCGTGAGGCCGTATGGGGAGGTGGAGTCAATAAGGTGCAGGACTTCTCTGTAGTTGTTTTCCGGATAAACGTAAACCACCAGCACCGGCCCGAATATCTCCTCTTGAATGATCTTCTCCTTGGGGTTTTTGCTCTCAATGATGGTCGGTTCCACGAAATACCCCTCGCTGTCGTCACACTTCCCTCCTGCTAGAATGGTGAGCTCCGGGGAGGATTGCGCGTGTTTTATCCAACCCTCCATCCGCCTGAGAGACTTCTGATCGATGACAGCGGAGAAGAAGGTGGAGAAGTCGTTGGGGGTCCCCGTTTTTATCTTGGCCAGTTTCTCCAGGAACCCCGCTCTCATCCGGGCCCCATCGAGTCCGGAACGTAGAAGCGGAAACAAGCCCAAGCACTCCTGCCCCCCCAACTCAAAAGCCTGAACGGAACGGTCCCAGTTCCCCACACTCCTCCCAGTCCGCCCCAAACTTTGAAACAAAGGGGAAAGATTTCTTCCCCCTCAGAATTTCTCCCCTAAAAAATTC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGCATATACGGGTACTTCCATT