ORFeome > arglu1 ORF1 – XORFeome v1.0

arglu1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arglu1
Gene ID: 5858199
Gene Page ID: 5857928
ORF Xenbase ID: 17264745

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC099017
Original XGC clone length: 798

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11089
Well Location: C05

Sequences - 5ʹ (forward) EST

Accession: JZ838451
dbEST ID: 79656153
Trimmed Sequence: ATGGGCCGTTCCCGGAGCCGGAGCTCTTCTCGATCAAAACACGTAAAAAGCGGCAAACACAACAAAAAACGGAGCCGCTCCCGAGAAAAGGAACGAGTTAGAAAACGCTCAAAGTCAAGGGAGAGTAAGAGGAACCGGCGCCGGGAGTCTCGCTCTAGGTCCCGCTCGAACACCGCCTCTCGGAGGGAAAGGGAGAGACCGGCATCACCGCCCGACAGAATCGACATCTTCGGTCGCACAGTGAGCAAAAGGAGCAGCCTGGACGAGAAGCAAAAGCGGGAGGAGGAGGAGAAGAAAGCAGAGTACGAGAGGCAGCGTAGGATTCGCCAGCAAGAAATTGAAGAAAAACTCATAGAAGAGGAGACGGCGCGGAGAGTAGAAGAATTAGTTGCCAAGCGTGTCGAGGAAGAGCTGGAGAAGAGGAAAGATGAAATTGAGCGAGAGGTTCTACGCAGGGTTGAGGAAGCTAAGCGCATCATGGAAAAGCAGTTGCTCGAAGAACTCGAGCGACAGAGGCAGGCCGAGCTATCTGCCCAAAAAGCCAGAGAGGAAGAACAAAAAAGATAACGTGAAGAGTTAGAGCGAATACTTGAAGAGAATAACCGTAAAATTGCTGATGCTCAGGGCGAGCGGGGCGAGGGAGCATTTAAAATTGTTTGAGGAGCGGGGAAAAGTCAGGAAGGAAAGGAGGAGCGGAGCAGCAGAAACCCCCCC
Full Trace Sequence: GGGGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGGCCGTTCCCGGAGCCGGAGCTCTTCTCGATCAAAACACGTAAAAAGCGGCAAACACAACAAAAAACGGAGCCGCTCCCGAGAAAAGGAACGAGTTAGAAAACGCTCAAAGTCAAGGGAGAGTAAGAGGAACCGGCGCCGGGAGTCTCGCTCTAGGTCCCGCTCGAACACCGCCTCTCGGAGGGAAAGGGAGAGACCGGCATCACCGCCCGACAGAATCGACATCTTCGGTCGCACAGTGAGCAAAAGGAGCAGCCTGGACGAGAAGCAAAAGCGGGAGGAGGAGGAGAAGAAAGCAGAGTACGAGAGGCAGCGTAGGATTCGCCAGCAAGAAATTGAAGAAAAACTCATAGAAGAGGAGACGGCGCGGAGAGTAGAAGAATTAGTTGCCAAGCGTGTCGAGGAAGAGCTGGAGAAGAGGAAAGATGAAATTGAGCGAGAGGTTCTACGCAGGGTTGAGGAAGCTAAGCGCATCATGGAAAAGCAGTTGCTCGAAGAACTCGAGCGACAGAGGCAGGCCGAGCTATCTGCCCAAAAAGCCAGAGAGGAAGAACAAAAAAGATAACGTGAAGAGTTAGAGCGAATACTTGAAGAGAATAACCGTAAAATTGCTGATGCTCAGGGCGAGCGGGGCGAGGGAGCATTTAAAATTGTTTGAGGAGCGGGGAAAAGTCAGGAAGGAAAGGAGGAGCGGAGCAGCAGAAACCCCCCC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCCGTTCCCGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838450
dbEST ID: 79656152
Trimmed Sequence: ATCTGGGTTTTTAAATGAGAAAGACAATTTTGGTCTTGATTTCCCCTTGCCCAATATGATTTTTTGCTCTTCTTTTTGCTGCCGTTGCCTTTCTTGATCTAGTTTCATCCTCTCCTCATGAATTTTCCTTTGCTCTTCAACAATTTTCAATTGCTCCTCGGCCAGTTTTGCCTGAGCATCAGCAATTTTACGGTTATTCTCTTCAAGTATTCGCTCTAACTCTTCACGTTTTCCTCTTTCTTCTTCCTCTCTGGCTTTTTGGGCAGATAGCTCGGCCTGCCTCTGTCGCTCGAGTTCTTCGAGCAACTGCTTTTCCATGATGCGCTTAGCTTCCTCAACCCTGCGTAGAACCTCTCGCTCAATTTCATCTTTCCTCTTCTCCAGCTCTTCCTCGACACGCTTGGGGGCTAATTCTTCTACTCTCCGCGCCGTCTCCTCTTCTATGAATTTTTCGTCGATTTCTTGCTGGCGAGGCCTACGCTACCTCTCTTACTCTGCTTTCTTCTCCTCCTCTTCTAACTTTTGCTTTTCTTTCCGGCTGCGGGTTTTTCTCACTGTGCGAGGGGGGAAATGGAGTCGGTCTTCCTTCGGAGGCGGTCCCTCCGTTTTCGTTCCCAAAAGCCAGGGTGCGAGCGGAGACAAGAGGCAAAAGGGCGGAGCTCCTTTATCTTTTT
Full Trace Sequence: GGGAAAACGGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAATCTGGGTTTTTAAATGAGAAAGACAATTTTGGTCTTGATTTCCCCTTGCCCAATATGATTTTTTGCTCTTCTTTTTGCTGCCGTTGCCTTTCTTGATCTAGTTTCATCCTCTCCTCATGAATTTTCCTTTGCTCTTCAACAATTTTCAATTGCTCCTCGGCCAGTTTTGCCTGAGCATCAGCAATTTTACGGTTATTCTCTTCAAGTATTCGCTCTAACTCTTCACGTTTTCCTCTTTCTTCTTCCTCTCTGGCTTTTTGGGCAGATAGCTCGGCCTGCCTCTGTCGCTCGAGTTCTTCGAGCAACTGCTTTTCCATGATGCGCTTAGCTTCCTCAACCCTGCGTAGAACCTCTCGCTCAATTTCATCTTTCCTCTTCTCCAGCTCTTCCTCGACACGCTTGGGGGCTAATTCTTCTACTCTCCGCGCCGTCTCCTCTTCTATGAATTTTTCGTCGATTTCTTGCTGGCGAGGCCTACGCTACCTCTCTTACTCTGCTTTCTTCTCCTCCTCTTCTAACTTTTGCTTTTCTTTCCGGCTGCGGGTTTTTCTCACTGTGCGAGGGGGGAAATGGAGTCGGTCTTCCTTCGGAGGCGGTCCCTCCGTTTTCGTTCCCAAAAGCCAGGGTGCGAGCGGAGACAAGAGGCAAAAGGGCGGAGCTCCTTTATCTTTTT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTGGGTTTTTAAATGAGAA