ORFeome > arl6ip6 ORF1 – XORFeome v1.0

arl6ip6 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: arl6ip6
Gene ID: 6252458
Gene Page ID: 973152
ORF Xenbase ID: 17264991

ORF full-length analysis tests

Full-Length confidence: low
Original XGC clone accession: BC126035
Original XGC clone length: 498

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: C10

Sequences - 5ʹ (forward) EST

Accession: JZ837560
dbEST ID: 79655262
Trimmed Sequence: ATGACTCCTCTCCGTTCAACAGCTGGCAGTGTGACAGAAGAATCGATGCCCAGTCCAAGCCCTGAGAAATTTGGACGTAATGGGACTGTTGTGTCACAAGTGGTGACTGTCAAACGGCATAAAAGATGGGCCACCCGAATTTTGTCAATGTTGTGCTGCCTTGTCGTTGTTTGCATTCTCTCTGTTTTGCTTGCAGTACTATATCTCGTTATACAAGACATGCAATCTGGAAGAGAAATTAATGACGAAGGAGAGAAGATTAGCCTTTTAGGATTCTGGAGTCTTCTTGCGTTGTCCCTTCTAGCGGGTCTATCCTGCTGCAGCTTCTCGTGGACTGTCACCTACTTTGATTCTTATGAACCAGGGATGTTTCCTCCAACTCCACTTTCTCCTGCACGCTTCAGGAAAATGACTGGCCATTCCTTCCACATGGGCTATACTATGGCAATACTCAATGGAGTTGTAGCAGCTCTGACAGTTCTCTGGTGTTTGCTATT
Full Trace Sequence: CGAGGGCCATATAATAGATTTTATTTTGACTGATAGTGACCTGGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGACTCCTCTCCGTTCAACAGCTGGCAGTGTGACAGAAGAATCGATGCCCAGTCCAAGCCCTGAGAAATTTGGACGTAATGGGACTGTTGTGTCACAAGTGGTGACTGTCAAACGGCATAAAAGATGGGCCACCCGAATTTTGTCAATGTTGTGCTGCCTTGTCGTTGTTTGCATTCTCTCTGTTTTGCTTGCAGTACTATATCTCGTTATACAAGACATGCAATCTGGAAGAGAAATTAATGACGAAGGAGAGAAGATTAGCCTTTTAGGATTCTGGAGTCTTCTTGCGTTGTCCCTTCTAGCGGGTCTATCCTGCTGCAGCTTCTCGTGGACTGTCACCTACTTTGATTCTTATGAACCAGGGATGTTTCCTCCAACTCCACTTTCTCCTGCACGCTTCAGGAAAATGACTGGCCATTCCTTCCACATGGGCTATACTATGGCAATACTCAATGGAGTTGTAGCAGCTCTGACAGTTCTCTGGTGTTTGCTATTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGCCATCCACCTGATACCCCCTATATTGAGTCGAAATAGATTGGTCTTAAATAAAAAAAAAAAAAAAAAAAAAAAAAATTAAAATAAAATAGAATCTTACAAACCACCAAGGAAAAAAAGTCTCTCCCCTTCCTGGCGCTCTTGGTTTTTTCGGTGGTGTTGCCGCGGGGGGGACGTGTAAAGGGAAAAAAAAAAAAGAAAGAAAACAAAATAAAAGATGTTTTAAATTAGA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACTCCTCTCCGTTCAA

Sequences - 3ʹ (reverse) EST

Accession: JZ837559
dbEST ID: 79655261
Trimmed Sequence: TAGCAAACACCAGAGAACTGTCAGAGCTGCTACAACTCCATTGAGTATTGCCATAGTATAGCCCATGTGGAAGGAATGGCCAGTCATTTTCCTGAAGCGTGCAGGAGAAAGTGGAGTTGGAGGAAACATCCCTGGTTCATAAGAATCAAAGTAGGTGACAGTCCACGAGAAGCTGCAGCAGGATAGACCCGCTAGAAGGGACAACGCAAGAAGACTCCAGAATCCTAAAAGGCTAATCTTCTCTCCTTCGTCATTAATTTCTCTTCCAGATTGCATGTCTTGTATAACGAGATATAGTACTGCAAGCAAAACAGAGAGAATGCAAACAACGACNAGGCAGCACAACATTGACAAAATTCGGGTGGCCCATCTTTTATGCCGTTTGACAGTCACCACTTGTGACACAACANTCCCATTACGTCCAAATTTCTCAGGGCTTGGACTGGGCATCGATTCTTCTGTCACACTGCCAGCTGTTGAACGGAGAGGAGTCATGG
Full Trace Sequence: GGAAAAACGGCTATGACGCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCGTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATAGCAAACACCAGAGAACTGTCAGAGCTGCTACAACTCCATTGAGTATTGCCATAGTATAGCCCATGTGGAAGGAATGGCCAGTCATTTTCCTGAAGCGTGCAGGAGAAAGTGGAGTTGGAGGAAACATCCCTGGTTCATAAGAATCAAAGTAGGTGACAGTCCACGAGAAGCTGCAGCAGGATAGACCCGCTAGAAGGGACAACGCAAGAAGACTCCAGAATCCTAAAAGGCTAATCTTCTCTCCTTCGTCATTAATTTCTCTTCCAGATTGCATGTCTTGTATAACGAGATATAGTACTGCAAGCAAAACAGAGAGAATGCAAACAACGACNAGGCAGCACAACATTGACAAAATTCGGGTGGCCCATCTTTTATGCCGTTTGACAGTCACCACTTGTGACACAACANTCCCATTACGTCCAAATTTCTCAGGGCTTGGACTGGGCATCGATTCTTCTGTCACACTGCCAGCTGTTGAACGGAGAGGAGTCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTATAAAAAAGCATTGCTCCATCATTTGTTGCACCAAACAGTCACTATCAATTCAAGTTAAATCCTTTATTTGGGGACCCAAAAAAAAAAAAAAACAGACAATTTACAACATCCGTGAACAGGGGCCCCACNAGAGAGAAAGGGGCCTCTATTTCTGTGCCCTCTTGTGTTGTCGGGGGTGTTCTGTGGTGGGAAAGCCGCAAGAAGAAGACCACCCCCGGGGGAGGAGAGAGCAGAAAAGGA
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGCAAACACCAGAGAACTGTC