ORFeome > asb1 ORF1 – XORFeome v1.0

asb1 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: asb1
Gene ID: 5793277
Gene Page ID: 5793267
ORF Xenbase ID: 17265183

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106414
Original XGC clone length: 984

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11087
Well Location: D03

Sequences - 5ʹ (forward) EST

Accession: JZ838014
dbEST ID: 79655716
Trimmed Sequence: ATGAACAGGGAAGAAGGAGCAGGCCGGAGCCTGAAGGCATGGTTGCAGGACAAGTACTGTGATCACCCATCAGAACAATGCCAGGATACCCGTTTGCACAATGCCGCCTGTGTGGGGGATATTGACACCCTGAGGAGCCTTCTACGGGATGAGAGGTTTCTAAGGTGTATAGATGAGCGAGCTGTGTGGTGTAGCGGCTGGCTGCCCTGTTCTCCCTTGCGCATTGCAGCCACGGCCGGACATGCTGACTGTGTGGAGCTCCTGATCCGCTCTGGGGCGCAGCTGGAGCTGGTTGATGTGAAGGGGCAGACCCCTCTCTATGTGGCTGCAGAAAATGGACACCTGGAATGTGTGAAAGTTCTGTTACGAGCAGGGGCAGACCCAAACGGCAGTCCCCATAATAGGAGCTCCCCTGTATACCATGCTGCACGTGTGGGCCGGGCTGACATACTGCAGGAATTGATCAAGTATGGTGCCGATGTCGATGTGGATCACCAGCTGTCTTTTCGTGGTTCTGGCTCCTCCCCTCGATTGCTGACATCTCTTGCCTCCTGTCCGCTCTATATTAATGCAACTTATCACAATCTAACCTGCCTTCACCTCCCTCTCCCGGCTGGTGGCAACCCCGACTATAAATATTTGGTAAAAAATATGCGAGGAAAACTTTCCAAAAAGGGGTTCCTTGTTTGCTACTTAAAGGCAATTTCTCCGCCATGAATTTTGATTCACCATTTTTTTCACCTTTCTTTTTTTATTTTTGGGGCAAATTTTGGAAAATTTGTTGCGGGGGAAAAACGCCGTGTGGGGAAGGGGAACAATTCCCCAG
Full Trace Sequence: TCGAGGGCCCAATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAACAGGGAAGAAGGAGCAGGCCGGAGCCTGAAGGCATGGTTGCAGGACAAGTACTGTGATCACCCATCAGAACAATGCCAGGATACCCGTTTGCACAATGCCGCCTGTGTGGGGGATATTGACACCCTGAGGAGCCTTCTACGGGATGAGAGGTTTCTAAGGTGTATAGATGAGCGAGCTGTGTGGTGTAGCGGCTGGCTGCCCTGTTCTCCCTTGCGCATTGCAGCCACGGCCGGACATGCTGACTGTGTGGAGCTCCTGATCCGCTCTGGGGCGCAGCTGGAGCTGGTTGATGTGAAGGGGCAGACCCCTCTCTATGTGGCTGCAGAAAATGGACACCTGGAATGTGTGAAAGTTCTGTTACGAGCAGGGGCAGACCCAAACGGCAGTCCCCATAATAGGAGCTCCCCTGTATACCATGCTGCACGTGTGGGCCGGGCTGACATACTGCAGGAATTGATCAAGTATGGTGCCGATGTCGATGTGGATCACCAGCTGTCTTTTCGTGGTTCTGGCTCCTCCCCTCGATTGCTGACATCTCTTGCCTCCTGTCCGCTCTATATTAATGCAACTTATCACAATCTAACCTGCCTTCACCTCCCTCTCCCGGCTGGTGGCAACCCCGACTATAAATATTTGGTAAAAAATATGCGAGGAAAACTTTCCAAAAAGGGGTTCCTTGTTTGCTACTTAAAGGCAATTTCTCCGCCATGAATTTTGATTCACCATTTTTTTCACCTTTCTTTTTTTATTTTTGGGGCAAATTTTGGAAAATTTGTTGCGGGGGAAAAACGCCGTGTGGGGAAGGGGAACAATTCCCCAG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACAGGGAAGAAGGAG

Sequences - 3ʹ (reverse) EST

Accession: JZ838013
dbEST ID: 79655715
Trimmed Sequence: AGGCAGTTCATGGAGTAGGAAGCACAACACTCGGGGTGGAACAGGAAGGTTGCAGGCAGAAGACAATCTCTGTTTTCCAAGTGCTCTCCTCACTATGATACGACACAGGCTGGAAAGTGAGCAAGGGCAAGCTTTAGCTTCATTAAAAACTTGAAGGGCTGTGGGGTTCACACTTATCCTTGGATGTTCCTCTGCACATGGCTCTCCCCGCACAAGTTTCAGATTTGCCCCAAAGTCAACAAGAAGCTGCACAAATTGCTGATCACATCCATGCCGCAGAACTGCCTCTAGTAAGCAACAAGGAGCCCCTCTTGGAAAGTTCTCCTCGCATACTTTTCCCCAATAATTATAGTCTGGGTTTGCACCACCCTGGAGCAGGAGGTGGAAGCAGGCGAGATTGTGATAAGCTGCACTAATATAAAGCGGACAGGAGGCGAGAGATGTCAGCAATCAAGGGGAGGAGCCAGAACCACGAAAAGACAGCTGGTGAGCGACATCGACATCGGCACCATACTTGATCAATTCCTGCAATAGGTCACCCCGCCCCCACCTCCCCCCAGGTAAACAGGGAGCCTCGATAAAGAGGATGGCGGTTGGGTGGGCCCGGGCTCTAAGAGAACTTTCACAATTTCAGGGTGTCGGTTTTGTGCACCCCTTGAAAAAAGGGGGCGGCCGGTTCCAACCGGGGCGACCCCCGCGCCCGCCGGCTAACGGGGAGGGGGGGAAGGCGGGGAGACTCAGCGAGTTAACGGGGGC
Full Trace Sequence: AAAACGGCTAATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAAGGCAGTTCATGGAGTAGGAAGCACAACACTCGGGGTGGAACAGGAAGGTTGCAGGCAGAAGACAATCTCTGTTTTCCAAGTGCTCTCCTCACTATGATACGACACAGGCTGGAAAGTGAGCAAGGGCAAGCTTTAGCTTCATTAAAAACTTGAAGGGCTGTGGGGTTCACACTTATCCTTGGATGTTCCTCTGCACATGGCTCTCCCCGCACAAGTTTCAGATTTGCCCCAAAGTCAACAAGAAGCTGCACAAATTGCTGATCACATCCATGCCGCAGAACTGCCTCTAGTAAGCAACAAGGAGCCCCTCTTGGAAAGTTCTCCTCGCATACTTTTCCCCAATAATTATAGTCTGGGTTTGCACCACCCTGGAGCAGGAGGTGGAAGCAGGCGAGATTGTGATAAGCTGCACTAATATAAAGCGGACAGGAGGCGAGAGATGTCAGCAATCAAGGGGAGGAGCCAGAACCACGAAAAGACAGCTGGTGAGCGACATCGACATCGGCACCATACTTGATCAATTCCTGCAATAGGTCACCCCGCCCCCACCTCCCCCCAGGTAAACAGGGAGCCTCGATAAAGAGGATGGCGGTTGGGTGGGCCCGGGCTCTAAGAGAACTTTCACAATTTCAGGGTGTCGGTTTTGTGCACCCCTTGAAAAAAGGGGGCGGCCGGTTCCAACCGGGGCGACCCCCGCGCCCGCCGGCTAACGGGGAGGGGGGGAAGGCGGGGAGACTCAGCGAGTTAACGGGGGC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGGCAGTTCATGGAGTAG