ORFeome > aspn ORF1 – XORFeome v1.0

aspn ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: aspn
Gene ID: 984763
Gene Page ID: 984761
ORF Xenbase ID: 17265267

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC084122
Original XGC clone length: 1140

Human orthology & disease relationships

NCBI Entrez ID: 54829
Ensembl gene IDs: ENSG00000106819
Directly associated (OMIM) disease MIM numbers: 603932,607850
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11006
Well Location: B03

Sequences - 5ʹ (forward) EST

Accession: JZ840012
dbEST ID: 79657714
Trimmed Sequence: ATGAAGGAATATTTGCTTTTCTATTTTCTGGCTTTGTGCTACGCTAAGCCATTTATTTTACCTCCAAAGTACATGGCACTGACTGACCTCATGTTAAAAGATATGGAAGATGACGACGATGACGACGATGACAATGATGATGATGATAATTCATTGTTTCCATTTAAAAAGAATCTACCAGTTCGACCTACGCCCCCTCCATTTGATTTATTTCCATCATGTCCATTTGGACGTCAGTGTTACTTAAAAATTGTTCAGTGCTCTGACCTTGGTTTGACCTCCATACCAAATAAAATCCCATATGACACTCGACTATTAGACCTTCAAAACAACAAAATAAAGGAGATCAAAGAAAAAGATCTGCAAGGCCTCACATCTCTTTCTGCTTTGTTTCTCAACAACAATAAACTATACAAGGTGCATCCAAAGGCATTCCAGTCTACAAAGAAGCTGCGACGGTTGTACTTGTCCCATAATCANCTCACAGAAATACCATCCAACCTTCCAAAATCATTGGCAGAGATCAGAATCCACGACCACAAAGTTAAAAAAGTACAAAAGGAAGCATTTAAAGGGATTCATTCATTACATGTTTTAAAAATGAATGCAAACCCACTGGAAAGTGAAAGAATAAAAACTGGAACATTTTGATTGAACTGACTGGGGTTCCACATTAGGATTTCAAAATGCCAAAATAACAATAATAACCAAAAAAATTACCACCATTCAATCAAATAAGCTCCACCCTTGAACCCCAAAAAAAATTCAAGAAAATTAAAAATTGGGAAAAATTTGTAAAAAAAAACAAAAAA
Full Trace Sequence: CGAGGCCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGAAGGAATATTTGCTTTTCTATTTTCTGGCTTTGTGCTACGCTAAGCCATTTATTTTACCTCCAAAGTACATGGCACTGACTGACCTCATGTTAAAAGATATGGAAGATGACGACGATGACGACGATGACAATGATGATGATGATAATTCATTGTTTCCATTTAAAAAGAATCTACCAGTTCGACCTACGCCCCCTCCATTTGATTTATTTCCATCATGTCCATTTGGACGTCAGTGTTACTTAAAAATTGTTCAGTGCTCTGACCTTGGTTTGACCTCCATACCAAATAAAATCCCATATGACACTCGACTATTAGACCTTCAAAACAACAAAATAAAGGAGATCAAAGAAAAAGATCTGCAAGGCCTCACATCTCTTTCTGCTTTGTTTCTCAACAACAATAAACTATACAAGGTGCATCCAAAGGCATTCCAGTCTACAAAGAAGCTGCGACGGTTGTACTTGTCCCATAATCANCTCACAGAAATACCATCCAACCTTCCAAAATCATTGGCAGAGATCAGAATCCACGACCACAAAGTTAAAAAAGTACAAAAGGAAGCATTTAAAGGGATTCATTCATTACATGTTTTAAAAATGAATGCAAACCCACTGGAAAGTGAAAGAATAAAAACTGGAACATTTTGATTGAACTGACTGGGGTTCCACATTAGGATTTCAAAATGCCAAAATAACAATAATAACCAAAAAAATTACCACCATTCAATCAAATAAGCTCCACCCTTGAACCCCAAAAAAAATTCAAGAAAATTAAAAATTGGGAAAAATTTGTAAAAAAAAACAAAAAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAGGAATATTTGCTTTTCTA

Sequences - 3ʹ (reverse) EST

Accession: JZ840011
dbEST ID: 79657713
Trimmed Sequence: CTTTCGGAAATTTCCAAGATGTACACTGTTTCTTCCCAGTGTGCAGCGGAATGTTGCTGGTTGAACCTCCCAGTATTTTACTGGATTCTTGAAAAGGCTTATACCACTGTACAGAGACTTCTTCAACTTGAGTCCTGTGGGGCAAAAATCATTCACATCTACTTTTCCAATATTATTGGAGTGAAGAAACAATACCTGTAGATATTTTAAATCTGCCAGCCCAGGTGGCACTCTCCTAAGTTTGTTGTTCTCCAAGTGAATTTCTCGTACATTTGGTATGCTAGCAAAACTTCCATTTTCAACATCTTTTATTTTATTGTGTCCTAAACCAAGTCTCTGAAGCTCTTTGTATCGTAACAAATCCTCAAGTTCAATTCCTGAAATTTTGTTGTGGTCAAGGTGGAGCTGATAGATTGATGTTGGTAAATCTTTAGGTATTGATGTTAGTTTGGCATCTGCAATCCTAATGTGGAACACAGTCAGTCCATCACATGCTCCAGGTTCTATTCCTTCACTTTCCAATGGATTGGCGCTCATTTCTAAAACATGTAATGAATGAATGCCTTTACGTGCTTCCTTTTGTACTTTTTTATCTTGTTTTGTCGGGGATTCTGAACGCCTGCCCATGAGTTTTGGGAGGGTGGAAGGGGAGTTCTTTAACTCTGATTAAGGGAACAAGTACAAGTCGCCCCCACCTTCCCTTCTAAAATTGAAATGGCTTTGGGGAGGGGCGGGTGGGGGGAGGTTGATTTGTTGTTTTCATAATTTTAG
Full Trace Sequence: AAACGGGCTAATGACCANTGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAACTTTCGGAAATTTCCAAGATGTACACTGTTTCTTCCCAGTGTGCAGCGGAATGTTGCTGGTTGAACCTCCCAGTATTTTACTGGATTCTTGAAAAGGCTTATACCACTGTACAGAGACTTCTTCAACTTGAGTCCTGTGGGGCAAAAATCATTCACATCTACTTTTCCAATATTATTGGAGTGAAGAAACAATACCTGTAGATATTTTAAATCTGCCAGCCCAGGTGGCACTCTCCTAAGTTTGTTGTTCTCCAAGTGAATTTCTCGTACATTTGGTATGCTAGCAAAACTTCCATTTTCAACATCTTTTATTTTATTGTGTCCTAAACCAAGTCTCTGAAGCTCTTTGTATCGTAACAAATCCTCAAGTTCAATTCCTGAAATTTTGTTGTGGTCAAGGTGGAGCTGATAGATTGATGTTGGTAAATCTTTAGGTATTGATGTTAGTTTGGCATCTGCAATCCTAATGTGGAACACAGTCAGTCCATCACATGCTCCAGGTTCTATTCCTTCACTTTCCAATGGATTGGCGCTCATTTCTAAAACATGTAATGAATGAATGCCTTTACGTGCTTCCTTTTGTACTTTTTTATCTTGTTTTGTCGGGGATTCTGAACGCCTGCCCATGAGTTTTGGGAGGGTGGAAGGGGAGTTCTTTAACTCTGATTAAGGGAACAAGTACAAGTCGCCCCCACCTTCCCTTCTAAAATTGAAATGGCTTTGGGGAGGGGCGGGTGGGGGGAGGTTGATTTGTTGTTTTCATAATTTTAG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCGGAAATTTCCAAGATGTAC