ORFeome > bves ORF2 – XORFeome v1.0

bves ORF2 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: bves
Gene ID: 865066
Gene Page ID: 484276
ORF Xenbase ID: 17266689

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC123356
Original XGC clone length: 1017

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11084
Well Location: E04

Sequences - 5ʹ (forward) EST

Accession: JZ837549
dbEST ID: 79655251
Trimmed Sequence: ATGGCTACAGAAAGCATATTGATCACAACTTTGCCAATGGATTTTAATTCTCAGATGAATAATGTTACAATTGGTTTAAATGACAATGAAACATTGTGTGAAAACTGGAGAGAAATACACCACTTAGTTTTTCATTTGGCAAACGCATGCTTTGCCGCAGGACTCGTTATTCCAAGCACTCTGAATCTTCACATGATTTTCCTACGTGGTATGCTGTGTCTAGGTTGCACTTTCTTCATCATTTGGGCTGTACTCTTCCGATGTGCTTTGGACATAATGATATGGAATGCTACCTTCCTTATCATCAACTTCATGCATTTTGTATACCTAGTGTATAAAAAAAGACCAATCAAAGTTAAAAATGATTTGAAGGATATCTATCACAGGATGTTTGAGCCTCTCCATGTATCTCCAGAATTATTCAATCGACTTACTGGGCAGTTCTGTGAAATGAAGACCTTAGCAAAAGGCCAGACATATGCAGTAGAAGATAAAACGTCTGTTGACGATCGTTTAAGTCTATTACTTATGGGAATAATGAAGGTGTCCTATCGAGGCCATTTTCTGCATACTATTTCTGCTAATGCTTACATCGATTCTCCTGAATTTCGATCAACAGAAATGAACCGTGGGGAAACATTTCAGGTCACTATCACTGCAGATGAAAACTGCGTATTTTTATGCTGGTCTCGAGAAAGACTAAAATATTTTTTGGAATCTGAACCCTTTTCTTTATGAAATATTTTAATATATTGAATTGGATAAAGAACGTTACGAGGCCAAACTTAAAACTCCCTTAAAAGAAAACCCCACAATTTGG
Full Trace Sequence: CGGGGCACATATAATAGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTACAGAAAGCATATTGATCACAACTTTGCCAATGGATTTTAATTCTCAGATGAATAATGTTACAATTGGTTTAAATGACAATGAAACATTGTGTGAAAACTGGAGAGAAATACACCACTTAGTTTTTCATTTGGCAAACGCATGCTTTGCCGCAGGACTCGTTATTCCAAGCACTCTGAATCTTCACATGATTTTCCTACGTGGTATGCTGTGTCTAGGTTGCACTTTCTTCATCATTTGGGCTGTACTCTTCCGATGTGCTTTGGACATAATGATATGGAATGCTACCTTCCTTATCATCAACTTCATGCATTTTGTATACCTAGTGTATAAAAAAAGACCAATCAAAGTTAAAAATGATTTGAAGGATATCTATCACAGGATGTTTGAGCCTCTCCATGTATCTCCAGAATTATTCAATCGACTTACTGGGCAGTTCTGTGAAATGAAGACCTTAGCAAAAGGCCAGACATATGCAGTAGAAGATAAAACGTCTGTTGACGATCGTTTAAGTCTATTACTTATGGGAATAATGAAGGTGTCCTATCGAGGCCATTTTCTGCATACTATTTCTGCTAATGCTTACATCGATTCTCCTGAATTTCGATCAACAGAAATGAACCGTGGGGAAACATTTCAGGTCACTATCACTGCAGATGAAAACTGCGTATTTTTATGCTGGTCTCGAGAAAGACTAAAATATTTTTTGGAATCTGAACCCTTTTCTTTATGAAATATTTTAATATATTGAATTGGATAAAGAACGTTACGAGGCCAAACTTAAAACTCCCTTAAAAGAAAACCCCACAATTTGG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTACAGAAAGCATATTGATC

Sequences - 3ʹ (reverse) EST

Accession: JZ837548
dbEST ID: 79655250
Trimmed Sequence: ACAGAAAACGGCATGCGACAAAGGACCCACTCCATATGCATTATAGAACTCTTGCTGGTTATGTCGCTGTGATGAGGTAGTAGAGGTTCCTCGCAGAAAGTTCTGCAAGCCATCTTCATGGTCACTTGTGCTGGCCAAACTGTTTCTCATCTCCATTACAGACAGTTGAGAGCAGAGACTAGGCTGAGTGTCTAGTTTTTTCTTCTTTCCCAATGTGGGATCATTGAGCGAGTATAGTTTGGTTGTAATGTCTTTACCAATCAAATATTTAAATATCTCATAAAGAAAAGGTTCAGATTCCAAAAAATATGTTAGTCTTTCTCGAGACCAGCATAAAAATACGCAGTTCTCATCTGCAGTGATAGTGACCTGAAATGTTTCCCCACGGTTCATTTCTGTTGATCGAAATTCAGGAGAATCGATGTAAGCATTAGCAGAAATAGTATGCAGAAAATGGCCTCGATAGGACACCTTCATTATTCCCATAAGTAATAAACTTAAACGATCGTCAACAGACGTTTTATCTTCTACTGCATATGTCTGGCCTTTTGCTAAGGTCCTCATTTCACAGAAATGCCCAGTAAGTCGATTGAATAATTCTGGAGATACGTGGAAAAGGTCAAACATCCTGTGATAGAAATCCGTTCAATTCTTTTTAAAATTTAATTGTCCTTTTGGTGTGGGCCTAATGTATACAAAATGGGGGGAAGTTGAAGGGAGAGGGGGGGGGAAGGAGGTGGGGAAGAGGTTAATTATTCCCAGAGCCCACCTCC
Full Trace Sequence: GGGAAAAGGCTATGGACCATGTAATACGACTCACTATAGGGGGATATCAGCNTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAACAGAAAACGGCATGCGACAAAGGACCCACTCCATATGCATTATAGAACTCTTGCTGGTTATGTCGCTGTGATGAGGTAGTAGAGGTTCCTCGCAGAAAGTTCTGCAAGCCATCTTCATGGTCACTTGTGCTGGCCAAACTGTTTCTCATCTCCATTACAGACAGTTGAGAGCAGAGACTAGGCTGAGTGTCTAGTTTTTTCTTCTTTCCCAATGTGGGATCATTGAGCGAGTATAGTTTGGTTGTAATGTCTTTACCAATCAAATATTTAAATATCTCATAAAGAAAAGGTTCAGATTCCAAAAAATATGTTAGTCTTTCTCGAGACCAGCATAAAAATACGCAGTTCTCATCTGCAGTGATAGTGACCTGAAATGTTTCCCCACGGTTCATTTCTGTTGATCGAAATTCAGGAGAATCGATGTAAGCATTAGCAGAAATAGTATGCAGAAAATGGCCTCGATAGGACACCTTCATTATTCCCATAAGTAATAAACTTAAACGATCGTCAACAGACGTTTTATCTTCTACTGCATATGTCTGGCCTTTTGCTAAGGTCCTCATTTCACAGAAATGCCCAGTAAGTCGATTGAATAATTCTGGAGATACGTGGAAAAGGTCAAACATCCTGTGATAGAAATCCGTTCAATTCTTTTTAAAATTTAATTGTCCTTTTGGTGTGGGCCTAATGTATACAAAATGGGGGGAAGTTGAAGGGAGAGGGGGGGGGAAGGAGGTGGGGAAGAGGTTAATTATTCCCAGAGCCCACCTCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGAAAACGGCATGCGA