ORFeome > c8orf76 ORF1 – XORFeome v1.0

c8orf76 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: c8orf76
Gene ID: 972594
Gene Page ID: 972588
ORF Xenbase ID: 17267289

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC130040
Original XGC clone length: 1095

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11090
Well Location: F04

Sequences - 5ʹ (forward) EST

Accession: JZ838578
dbEST ID: 79656280
Trimmed Sequence: ATGGACGCCACCATGGGTTTTTGTTTCGAGGACTCGGATTTTGCGGAACCCACATCTCGACTGAAGGGGACAGGGGAACCTTATGTGGCCAAGCAGTGCGAGCCGCAGTGGTTCACAGAAGAAGTGGATAGTGAAGATTCCGTTGAGATTGTCACCGCGCTGAAGTTCAGAGCAGATATGGCCTACAGACTGAAAGACTTTGAGAAAGCACTTGGGGATTATTGCAGTTGTTTCCTGCTGTTGCCACCTACCAACACTGCAATGAGAAGGGACGTCCAGGAAAGCCAGGCGCGCTGTTTAATTAACCTGGGACGATATACAGAAGCTTTGGAGATAGCCGAGAGTCTGGGAAATGGTGTATTTAACACCGACCACTTGACGTGTACCCTCAACCTACAAGTCGCCATATTGGATCATCTGGGGAACCTGCCAAAAGTCATATCTTGTTTGCAGCAGCTGATTTCTTTACACCCATTGAATCCGTGGATTTGGAAGAGACTGGCTGAGTTCTACACAAGGGCCCATCTCGCTGCCTCCAATCAGGCGACAGGATCTGTGGAAAAAAATCGCTTTGAGCCGCATCCACAAAGTATACTGGTTTAATAATCCCCAGGCAGTGGAAGGGAAGGGAACGAGAAAAACCAAAGGGACTTGATAACTTTTTCTAAATTAAAGAAATCCCCTCCTGCCGTATCCCAAAGGGGAAAACCAACAATAAAACCTAATTGGATATAATGTAGGCTTCCCTTTTTGAAATTTTAGGCCCAAAAGGAAAACCCCTTTTATTTTTCCCTGTGGGTCCTTTTTTTTCTCCCCAAAC
Full Trace Sequence: CGGGGGCCACATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGACGCCACCATGGGTTTTTGTTTCGAGGACTCGGATTTTGCGGAACCCACATCTCGACTGAAGGGGACAGGGGAACCTTATGTGGCCAAGCAGTGCGAGCCGCAGTGGTTCACAGAAGAAGTGGATAGTGAAGATTCCGTTGAGATTGTCACCGCGCTGAAGTTCAGAGCAGATATGGCCTACAGACTGAAAGACTTTGAGAAAGCACTTGGGGATTATTGCAGTTGTTTCCTGCTGTTGCCACCTACCAACACTGCAATGAGAAGGGACGTCCAGGAAAGCCAGGCGCGCTGTTTAATTAACCTGGGACGATATACAGAAGCTTTGGAGATAGCCGAGAGTCTGGGAAATGGTGTATTTAACACCGACCACTTGACGTGTACCCTCAACCTACAAGTCGCCATATTGGATCATCTGGGGAACCTGCCAAAAGTCATATCTTGTTTGCAGCAGCTGATTTCTTTACACCCATTGAATCCGTGGATTTGGAAGAGACTGGCTGAGTTCTACACAAGGGCCCATCTCGCTGCCTCCAATCAGGCGACAGGATCTGTGGAAAAAAATCGCTTTGAGCCGCATCCACAAAGTATACTGGTTTAATAATCCCCAGGCAGTGGAAGGGAAGGGAACGAGAAAAACCAAAGGGACTTGATAACTTTTTCTAAATTAAAGAAATCCCCTCCTGCCGTATCCCAAAGGGGAAAACCAACAATAAAACCTAATTGGATATAATGTAGGCTTCCCTTTTTGAAATTTTAGGCCCAAAAGGAAAACCCCTTTTATTTTTCCCTGTGGGTCCTTTTTTTTCTCCCCAAAC
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACGCCACCATGGGTT

Sequences - 3ʹ (reverse) EST

Accession: JZ838577
dbEST ID: 79656279
Trimmed Sequence: GCAGGAGTAGAGCGAGACGATTTTCTGGAACCACTTGTCTTTAAACTCGGAATCGGAGGGCATTCTGAATGTGGACAGCGCCAGAGTGCTTTTTGTGTCAGCAGCCCCTTCATCTTTTATATGTTCTGGCAAAAGATCTTCTCCCATCATCTCTGCCATGTGGCTTTCAATTGTGTCTTTCAGTCTGAAAACCTTCAGCTGCTCTTCGATTTCCCCTTGGGCCTTTAGATTCTTATGCAGCACAAAGGAGGCCTGCTGAGGCTGCACAAGCTGGAGGAGAAGCCTTGCTCGGATGAAAGATGCCCATGAGAACATCAAGAGATCTGTTTTGGTGCCTAATTCCAACAAGGAGAGCCTACAATAATCCACATCAGTTTTATTGATGGGTCTCCCCGTCTGACTACAGCAGTGAGAGATTTCTTTACTTCTGAAAAACATATTCAAGTCCCTTTGCTTTTCTCGTTCCTTTCCTTCCACTGACATGGGATTATTTAACAGTATACTCTCTAGATGCGGCTCAAAGCGATTTTTCTCCACAGATCCTGTCGCCTGATTGGAGGCAGCGAGATGGGCCCTTGTGTAGAATTCAGCAAGTCTCTTCCAAATCCACGGATTCAATGGGTGTAAAGAAATCAGCTGCTTGCAACAAGATAATGACTTTTGGCAAGGTCCCCCGAATAACCAATAATGGCAACCTGGAAGGTTTGAGGGTAAGCCGGTCAAGGGGGGCCCGGTGTTAAGATAAGGCCCGTTTCCCCCAAACCCTCCCGGCT
Full Trace Sequence: AAAACGGCTATTGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGCAGGAGTAGAGCGAGACGATTTTCTGGAACCACTTGTCTTTAAACTCGGAATCGGAGGGCATTCTGAATGTGGACAGCGCCAGAGTGCTTTTTGTGTCAGCAGCCCCTTCATCTTTTATATGTTCTGGCAAAAGATCTTCTCCCATCATCTCTGCCATGTGGCTTTCAATTGTGTCTTTCAGTCTGAAAACCTTCAGCTGCTCTTCGATTTCCCCTTGGGCCTTTAGATTCTTATGCAGCACAAAGGAGGCCTGCTGAGGCTGCACAAGCTGGAGGAGAAGCCTTGCTCGGATGAAAGATGCCCATGAGAACATCAAGAGATCTGTTTTGGTGCCTAATTCCAACAAGGAGAGCCTACAATAATCCACATCAGTTTTATTGATGGGTCTCCCCGTCTGACTACAGCAGTGAGAGATTTCTTTACTTCTGAAAAACATATTCAAGTCCCTTTGCTTTTCTCGTTCCTTTCCTTCCACTGACATGGGATTATTTAACAGTATACTCTCTAGATGCGGCTCAAAGCGATTTTTCTCCACAGATCCTGTCGCCTGATTGGAGGCAGCGAGATGGGCCCTTGTGTAGAATTCAGCAAGTCTCTTCCAAATCCACGGATTCAATGGGTGTAAAGAAATCAGCTGCTTGCAACAAGATAATGACTTTTGGCAAGGTCCCCCGAATAACCAATAATGGCAACCTGGAAGGTTTGAGGGTAAGCCGGTCAAGGGGGGCCCGGTGTTAAGATAAGGCCCGTTTCCCCCAAACCCTCCCGGCT
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGGAGTAGAGCGAGA