ORFeome > ccnd1 ORF3 – XORFeome v1.0

ccnd1 ORF3 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: ccnd1
Gene ID: 6251625
Gene Page ID: 6077305
ORF Xenbase ID: 17268249

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC106631
Original XGC clone length: 876

Human orthology & disease relationships

NCBI Entrez ID: 595
Ensembl gene IDs: ENSG00000110092
Directly associated (OMIM) disease MIM numbers: 114500,193300,254500
Indirectly associated (Lage, et al.) disease MIM numbers: 109800,114480,125853,132600,151623,155255,259500,608089,609048

Library Location

Plate ID: GDExl11085
Well Location: G08

Sequences - 5ʹ (forward) EST

Accession: JZ837705
dbEST ID: 79655407
Trimmed Sequence: ATGGAGCTTTTGTGCTGCGAGGTGGACACCATCAGGAGGGCCCATCTGGACAGGAACCTCATCACGGACCGGGTGCTGCAGACAATGCTCAAAGCAGAGGAGACCTCCTGCCCCAGCGTGTCCTATTTCAAGTGCGTCCAGAAGGAGGTCCTGCCCAACATGCGCAAAATAGTGGCCACCTGGATGCTGGAGGTGTGCGAGGAGCAGAAGTGCGAAGAGGAAGTTTTCCCCCTTGCTATGAACTATTTGGACCGATTCCTGTCCGTGGAGCCCCTCCGGAAGAGCCGACTGCAGTTGCTGGGGGCCACTTGTATGTTTTTGGCTTCTAAAATGAAGGAAACGATCCCACTGACCGCAGAGAAGCTTTGCATTTACACGGACAATTCCATCAGGCCAGACGAGTTACTGCTAATGGAACTGCTGATTTTGAACAAACTGAAATGGGACTTGGCATCTGTGACCCCCCATGACTTTATTGAACATTTTCTAAACAAAATGCCACTGACTGAGGATACCAAGCAGATCATCCGCAAACACGCCCAGACATTTGTTGCCCTCTGCGCTACAGATGTAAAGTTTATCTCCAATCCACCCTCCATGATCGCCGCCGGCAGTGTTTCAACACCTGTTCAGGGACTAAATTTGGGAAACCCAGAAAGTGTCTTCTTCCACCCCACGCCTCACACTTTTCCTATCCCAGGCCAACAAATGTTACCCCGAACGGTTTACCGGGCCTGCCCAAAAAAGAATGAA
Full Trace Sequence: CGAGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGAGCTTTTGTGCTGCGAGGTGGACACCATCAGGAGGGCCCATCTGGACAGGAACCTCATCACGGACCGGGTGCTGCAGACAATGCTCAAAGCAGAGGAGACCTCCTGCCCCAGCGTGTCCTATTTCAAGTGCGTCCAGAAGGAGGTCCTGCCCAACATGCGCAAAATAGTGGCCACCTGGATGCTGGAGGTGTGCGAGGAGCAGAAGTGCGAAGAGGAAGTTTTCCCCCTTGCTATGAACTATTTGGACCGATTCCTGTCCGTGGAGCCCCTCCGGAAGAGCCGACTGCAGTTGCTGGGGGCCACTTGTATGTTTTTGGCTTCTAAAATGAAGGAAACGATCCCACTGACCGCAGAGAAGCTTTGCATTTACACGGACAATTCCATCAGGCCAGACGAGTTACTGCTAATGGAACTGCTGATTTTGAACAAACTGAAATGGGACTTGGCATCTGTGACCCCCCATGACTTTATTGAACATTTTCTAAACAAAATGCCACTGACTGAGGATACCAAGCAGATCATCCGCAAACACGCCCAGACATTTGTTGCCCTCTGCGCTACAGATGTAAAGTTTATCTCCAATCCACCCTCCATGATCGCCGCCGGCAGTGTTTCAACACCTGTTCAGGGACTAAATTTGGGAAACCCAGAAAGTGTCTTCTTCCACCCCACGCCTCACACTTTTCCTATCCCAGGCCAACAAATGTTACCCCGAACGGTTTACCGGGCCTGCCCAAAAAAGAATGAA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCTTTTGTGCTGCGA

Sequences - 3ʹ (reverse) EST

Accession: JZ837704
dbEST ID: 79655406
Trimmed Sequence: GATATTGACGTCTCGGACATCGGTCGGGGTGCAGGAGATATCCACCTCTTCTTCCATGTTTTTTGTGTCTGAGGAAGTGTTGTGTTGCTGCTGTGCTTGGCGCAAACTGGACTCTAGGAGGGACTCAATCTGTTCTTGGCACGCCCGTAAACAGTCCGGGTCACATTTGATGACCTGTGATAGGAAAAGTGTGAGGCGTTGGGTGGAGAAGACACCATCTGCGTTTCCCAAATTTAGTCCCTGAACAGCTGCTGCAACACTGCCGGCGGCGATCATGGAGGGTGGATTGGAGATAAACTTTACATCTGTAGCGCAGAGGGCAACAAATGTCTGGGCGTGTTTGCGGATGATCTGCTTGGTATCCTCAGTCAGTGGCATTTTGTTTAGAAAATGTTCAATAAAGTCATGGGGGGTCACAGATGCCAAGTCCCATTTCAGTTTGTTCGAAATCGGCAGTTCCATTAGCAGTAACTCGTCTGGCCTGAGGGAATTGTCCGTGTAGATGCGGAGCTTCGCTGCGATCAGTGGGAGGGTTTCCTTCATTTTAGAAGCCGGAAACATACAAGTGGGGGCGGGGAACTGGGGTCGGGTCTTCGGGGAGGGCGGGGGGGGACAGGAGTCGGGTCGAATAGTTGATAGTGAGGGGGAAGGGGGCATGCTTGCGCGTCCGGTCGTCGCGCACGGCGGGAGGCGGGGGGCGGGGAGTTGCGCAGTTGGGGAGGAGGGCCGGCGGGACGGGGGGAAATAAGGAACGCGGGGCGGGGGGGGTGGGGGGGTGGGAGGGTTGGGGGGGCGGCCGGGCCGGGAGGAGGTGGGGGGGGGAGGGGCGGCGAGGGGGGAGCGGCTCGGAGAAAGGAGAGGGCAAGGGCGGGGGGGGGTGGGGAGAGTGGGGTGGGAAAAAAGAAGGGGGGGGCGGGGGTGGAGGGGAGGGTAAAAAAAAAAAAAAAAAAAGGAAAAAATTAAAGACCCAGCACAAAGGAGGGGACGGGGCTATTGCACAGCCCNATGCGAGGAGGAGGGGGGGGGGGGGGCGGGGANAGGCGGGGAGAGGGAGGGGGGAGAGGNCGGCGNGGAGGGNAAGGAGGCNAGGGGAAAGNGGGGGGGGGGGGGAAGGAAGGAGNNGGCANCCAAGGAGGGGGGGGNAGTGGCTGGGGTGCGGGGGGCGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGAGGGGGGGAGG
Full Trace Sequence: GGCCGGGGAACAGCTTATGACCATGGTAATACGACTCACTACTAGGGGATATCAGCTCGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGATATTGACGTCTCGGACATCGGTCGGGGTGCAGGAGATATCCACCTCTTCTTCCATGTTTTTTGTGTCTGAGGAAGTGTTGTGTTGCTGCTGTGCTTGGCGCAAACTGGACTCTAGGAGGGACTCAATCTGTTCTTGGCACGCCCGTAAACAGTCCGGGTCACATTTGATGACCTGTGATAGGAAAAGTGTGAGGCGTTGGGTGGAGAAGACACCATCTGCGTTTCCCAAATTTAGTCCCTGAACAGCTGCTGCAACACTGCCGGCGGCGATCATGGAGGGTGGATTGGAGATAAACTTTACATCTGTAGCGCAGAGGGCAACAAATGTCTGGGCGTGTTTGCGGATGATCTGCTTGGTATCCTCAGTCAGTGGCATTTTGTTTAGAAAATGTTCAATAAAGTCATGGGGGGTCACAGATGCCAAGTCCCATTTCAGTTTGTTCGAAATCGGCAGTTCCATTAGCAGTAACTCGTCTGGCCTGAGGGAATTGTCCGTGTAGATGCGGAGCTTCGCTGCGATCAGTGGGAGGGTTTCCTTCATTTTAGAAGCCGGAAACATACAAGTGGGGGCGGGGAACTGGGGTCGGGTCTTCGGGGAGGGCGGGGGGGGACAGGAGTCGGGTCGAATAGTTGATAGTGAGGGGGAAGGGGGCATGCTTGCGCGTCCGGTCGTCGCGCACGGCGGGAGGCGGGGGGCGGGGAGTTGCGCAGTTGGGGAGGAGGGCCGGCGGGACGGGGGGAAATAAGGAACGCGGGGCGGGGGGGGTGGGGGGGTGGGAGGGTTGGGGGGGCGGCCGGGCCGGGAGGAGGTGGGGGGGGGAGGGGCGGCGAGGGGGGAGCGGCTCGGAGAAAGGAGAGGGCAAGGGCGGGGGGGGGTGGGGAGAGTGGGGTGGGAAAAAAGAAGGGGGGGGCGGGGGTGGAGGGGAGGGTAAAAAAAAAAAAAAAAAAAGGAAAAAATTAAAGACCCAGCACAAAGGAGGGGACGGGGCTATTGCACAGCCCNATGCGAGGAGGAGGGGGGGGGGGGGGCGGGGANAGGCGGGGAGAGGGAGGGGGGAGAGGNCGGCGNGGAGGGNAAGGAGGCNAGGGGAAAGNGGGGGGGGGGGGGAAGGAAGGAGNNGGCANCCAAGGAGGGGGGGGNAGTGGCTGGGGTGCGGGGGGCGGGGGGGGGGGGAGGGGGGGGGGGGGGGGGAGGGGGGGAGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATATTGACGTCTCGGACAT