ORFeome > cdk9 ORF1 – XORFeome v1.0

cdk9 ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: cdk9
Gene ID: 6256565
Gene Page ID: 483720
ORF Xenbase ID: 17268885

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC045247
Original XGC clone length: 1131

Human orthology & disease relationships

NCBI Entrez ID: 1025
Ensembl gene IDs: ENSG00000136807
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers: 151623,214150,216400,601675,607136

Library Location

Plate ID: GDExl11013
Well Location: E06

Sequences - 5ʹ (forward) EST

Accession: JZ824120
dbEST ID: 79641822
Trimmed Sequence: ATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCCAGAAGGTGTGGGCCAAATGTGGAACAAATAACAAGGTTG
Full Trace Sequence: CAATATTGAATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGTAAAGAACTACGACTCTGTTGAATTCCCTTATTGCGATGAGGTCTCCAAGTACGAGCGGCTCGCCAAGATCGGCCAGGGCACATTCGGGGAAGTGTTCAAGGCCAAACATCGGCAGACGGGGAAGAAAGTTGCACTCAAAAAAGTTCTGATGGAAAATGAGAAGGAAGGGTTCCCTATCACAGCTCTGCGAGAGATCAAAATCCTGCAGCTGTTGAAACATGAGAATGTGGTTCACCTTATAGAGATTTGTCGGAATAAAATTTCTCCCACAGCCAACCAATACAATAGATGCAAAGGGACTATTTTCCTGGTGTTCGACTTTTGCGAGCACGATCTAGCAGGATTGCTGAGCAACGCTCACGTCAAGTTTACCGTCGCCGAGATCAAGAAGGTGATGCAGATGCTGCTCAATGGCCTCTACTACATTCACAGGAATAAGATCCTGCACAGAGACATGAAGGCAGCAAACGTGCTGATCACCAGAGACGGGGTGTTGAAACTTGCAGACTTTGGGCTTGCCAGAGCATTCAGCCTTGCCAAGAACAGCCAGCCAAACAAGTACACCAATCGGGTTGTTACACTCTGGTATCGACCCCCTGAGCTGCTTCTGGGGGAGCGTGATTATGGCCCTCCCATCGATTTGTGGGGAGCGGGGTGCATCATGGCAGAGATGTGGACCAGAAGCCCCATTATGCAGGGGAATACAGAGCAGCATCAGCTGACACTCATCAGCCAATTGTGCGGCTCCATCACACCCAGAAGGTGTGGGCCAAATGTGGAACAAATAACAAGGTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAAAGAACTACGACTCTG

Sequences - 3ʹ (reverse) EST

Accession: JZ829428
dbEST ID: 79647130
Trimmed Sequence: GAAGACTCTGTCAAATTCTGATTGGTTGGTGGCAGCAGGATTCCGTGCCTGATTGGCTGGCTGTTGGGGCATGTGTCCGCCTCTTCTCCTAGGAGGTGCCAAGTATTCAAACATGGACTGATTGTGAGTAGAGAGCATGTTCTTTAGGTCAGAAGGCATTGGATCGGACCAGAAGAAATCGTGGTTCAGAGCTTCGTCGCTGTCTGTTCTCTGCGCTGGGTCCAAAATCAACAGCTTGTCTATAAGATCCAGTGCACAGACATCTTTCACATAAGCCTTCAGCCTTTCCTTCACCTTCCTCTTCTGGCCTTTGGGCAGCTCAAGTTTCTGGTACAACTCGTATTTGTCCACATTTGGCCACACCTCTGGTGTGATGGAGCCGCACAATTGGCTGATGAGTGTCAGCTGATGCTGCTCTGTATTCCCCTGCATAATGGGGCTTCTGGTCCACATCTCTGCCATGATGCACCCCGCTCCCCACAAATCGATGGGAGGGCCATAATCACGCTCCCCCAGAAGCAGCTCAGGGGGTCGATACCAGAGTGTAACAACCCGATTGTTGTACTTGTTTTGGCTGGCTGTTTCTGGCAAGGCTGAATGCTCTGGCAAGCCCAAAGTCTGCAAGTTTTCACACCCCGTCCCGGGTGGTCACCACGTTTGCCGCCCTTCAGGTCTCTTTGGCAGGAACTTATTCCCGGTGGAAGGTATAAAAAAGGCCCATTGGGCCAACCACCCTGCCTTCCCCTTTCCTTTAATTCTCGG
Full Trace Sequence: CCTGCCAGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGAAGACTCTGTCAAATTCTGATTGGTTGGTGGCAGCAGGATTCCGTGCCTGATTGGCTGGCTGTTGGGGCATGTGTCCGCCTCTTCTCCTAGGAGGTGCCAAGTATTCAAACATGGACTGATTGTGAGTAGAGAGCATGTTCTTTAGGTCAGAAGGCATTGGATCGGACCAGAAGAAATCGTGGTTCAGAGCTTCGTCGCTGTCTGTTCTCTGCGCTGGGTCCAAAATCAACAGCTTGTCTATAAGATCCAGTGCACAGACATCTTTCACATAAGCCTTCAGCCTTTCCTTCACCTTCCTCTTCTGGCCTTTGGGCAGCTCAAGTTTCTGGTACAACTCGTATTTGTCCACATTTGGCCACACCTCTGGTGTGATGGAGCCGCACAATTGGCTGATGAGTGTCAGCTGATGCTGCTCTGTATTCCCCTGCATAATGGGGCTTCTGGTCCACATCTCTGCCATGATGCACCCCGCTCCCCACAAATCGATGGGAGGGCCATAATCACGCTCCCCCAGAAGCAGCTCAGGGGGTCGATACCAGAGTGTAACAACCCGATTGTTGTACTTGTTTTGGCTGGCTGTTTCTGGCAAGGCTGAATGCTCTGGCAAGCCCAAAGTCTGCAAGTTTTCACACCCCGTCCCGGGTGGTCACCACGTTTGCCGCCCTTCAGGTCTCTTTGGCAGGAACTTATTCCCGGTGGAAGGTATAAAAAAGGCCCATTGGGCCAACCACCCTGCCTTCCCCTTTCCTTTAATTCTCGG
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGACTCTGTCAAATTCTGATTG