ORFeome > cetn1 ORF1 – XORFeome v1.0

cetn1 ORF1 – XORFeome v1.0

General Information

Species: Xla
Gene Symbol: cetn1
Gene ID: 967622
Gene Page ID: 967616
ORF Xenbase ID: 17269245

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC054948
Original XGC clone length: 519

Human orthology & disease relationships

NCBI Entrez ID:
Ensembl gene IDs:
Directly associated (OMIM) disease MIM numbers:
Indirectly associated (Lage, et al.) disease MIM numbers:

Library Location

Plate ID: GDExl11001
Well Location: G11

Sequences - 5ʹ (forward) EST

Accession: JZ839080
dbEST ID: 79656782
Trimmed Sequence: ATGGCTTCTAACTACAAGAAACCATCTTTAGGAGTGACAACTCAGAGAAAGAAACCTGTCCCAAAAACTGAGCTCACAGAAGAACAGAAACAAGAAATTCGGGAAGCTTTTGATCTTTTTGATACAGATGGAACTGGGACCATAGATGTTAAGGAGCTAAAGGTCGCCATGCGAGCATTGGGATTTGAGCCAAAAAAGGAAGAAATCAAGAAAATGATTGCTGATATTGATAAAGAAGGCACTGGAAAAATAGCTTTCAGTGATTTTATGTCTGCAATGACACAGAAAATGGCTGAAAAGGATTCCAAAGAAGAGATAATGAAGGCATTCAAGTTATTTGATGATGATGAAACAGGAAAGATATCATTCAAGAACCTGAAACGGGTGGCTAAGGAGCTTGGTGAAAACCTTACAGATGAAGAATTGCAGGAAATGATTGATGAAGCTGACCGAGATGGAGATGGCGAAGTCAATGAACAAGAATTTCTTAGAATAATGAAGAAGACCAGTTTATACTT
Full Trace Sequence: GGGGGGTCTAGCTCGGGCCCAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTAACTACAAGAAACCATCTTTAGGAGTGACAACTCAGAGAAAGAAACCTGTCCCAAAAACTGAGCTCACAGAAGAACAGAAACAAGAAATTCGGGAAGCTTTTGATCTTTTTGATACAGATGGAACTGGGACCATAGATGTTAAGGAGCTAAAGGTCGCCATGCGAGCATTGGGATTTGAGCCAAAAAAGGAAGAAATCAAGAAAATGATTGCTGATATTGATAAAGAAGGCACTGGAAAAATAGCTTTCAGTGATTTTATGTCTGCAATGACACAGAAAATGGCTGAAAAGGATTCCAAAGAAGAGATAATGAAGGCATTCAAGTTATTTGATGATGATGAAACAGGAAAGATATCATTCAAGAACCTGAAACGGGTGGCTAAGGAGCTTGGTGAAAACCTTACAGATGAAGAATTGCAGGAAATGATTGATGAAGCTGACCGAGATGGAGATGGCGAAGTCAATGAACAAGAATTTCTTAGAATAATGAAGAAGACCAGTTTATACTTGCCAACTTTCTTGTACAAAGTTGGCATTATAAGAAAGCATTGCTTATCAATTTGTTGCAACGAACAGGTCACTATCAGTCAAAATAAAATCATTATTTGGCATCCAGCTGATATCCCCTATAGTGAGTCGTATTAAAAAAAAGAAAATGGTTACCTTGGCAGCTCTGGCCCCGGTCTCAAATCTTTTAAAATGTACAAAAAGGGCGCCCAAGGGTGCCGGGGGCCTCCCCTTTGGAAGGTGGTTGAGGGCGGAAACCCTGCGTAATAATAGCAAATTTG
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTCTAACTACAAGAAACC

Sequences - 3ʹ (reverse) EST

Accession: JZ839079
dbEST ID: 79656781
Trimmed Sequence: GTATAAACTGGTCTTCTTCATTATTCTAAGAAATTCTTGTTCATTGACTTCGCCATCTCCATCTCGGTCAGCTTCATCAATCATTTCCTGCAATTCTTCATCTGTAAGGTTTTCACCAAGCTCCTTAGCCACCCGTTTCAGGTTCTTGAATGATATCTTTCCTGTTTCATCATCATCAAATAACTTGAATGCCTTCATTATCTCTTCTTTGGAATCCTTTTCAGCCATTTTCTGTGTCATTGCAGACATAAAATCACTGAAAGCTATTTTTCCAGTGCCTTCTTTATCAATATCAGCAATCATTTTCTTGATTTCTTCCTTTTTTGGCTCAAATCCCAATGCTCGCATGGCGACCTTTAGCTCCTTAACATCTATGGTCCCAGTTCCATCTGTATCAAAAAGATCAAAAGCTTCCCGAATTTCTTGTTTCTGTTCTTCTGTGAGCTCAGTTTTTGGGACAGGTTTCTTTCTCTGAGTTGTCACTCCTAAAGATGGTTTCTTGTAGTTAGAAGCCATGG
Full Trace Sequence: GACAGGGAACAGCTATGACCATGTAATACGACTCACTATAGGGGGATATCAGCTGGGATGGCAAATAATGATTTTATTTTGACTGATANTGACCTGTTCNTTGCAACAAATTGATAANCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAAGTATAAACTGGTCTTCTTCATTATTCTAAGAAATTCTTGTTCATTGACTTCGCCATCTCCATCTCGGTCAGCTTCATCAATCATTTCCTGCAATTCTTCATCTGTAAGGTTTTCACCAAGCTCCTTAGCCACCCGTTTCAGGTTCTTGAATGATATCTTTCCTGTTTCATCATCATCAAATAACTTGAATGCCTTCATTATCTCTTCTTTGGAATCCTTTTCAGCCATTTTCTGTGTCATTGCAGACATAAAATCACTGAAAGCTATTTTTCCAGTGCCTTCTTTATCAATATCAGCAATCATTTTCTTGATTTCTTCCTTTTTTGGCTCAAATCCCAATGCTCGCATGGCGACCTTTAGCTCCTTAACATCTATGGTCCCAGTTCCATCTGTATCAAAAAGATCAAAAGCTTCCCGAATTTCTTGTTTCTGTTCTTCTGTGAGCTCAGTTTTTGGGACAGGTTTCTTTCTCTGAGTTGTCACTCCTAAAGATGGTTTCTTGTAGTTAGAAGCCATGGTGCCAACTTTTTTGTACAAAGTTGGCATTAATAAAAAGCATTGGTCATTCATTTGTTGCAACGAACAGGGTCACTACAAGTAAAATTAAATCAAAATGTGAGGGCCCGAGTTTAACAATGGGCGTCGTTTTTCAACTTCTGGGACTTGGGGAGGTTCN
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTATAAACTGGTCTTCTTC