ORFeome > chm ORF1 – XORFeome v1.0

chm ORF1 – XORFeome v1.0

General Information

Species: Xl
Gene Symbol: chm
Gene ID: 956392
Gene Page ID: 956388
ORF Xenbase ID: 17269395

ORF full-length analysis tests

Full-Length confidence: high
Original XGC clone accession: BC061662
Original XGC clone length: 1932

Human orthology & disease relationships

NCBI Entrez ID: 1121
Ensembl gene IDs: ENSG00000188419
Directly associated (OMIM) disease MIM numbers: 303100
Indirectly associated (Lage, et al.) disease MIM numbers: 303100

Library Location

Plate ID: GDExl11021
Well Location: B11

Sequences - 5ʹ (forward) EST

Accession: JZ824795
dbEST ID: 79642497
Trimmed Sequence: ATGGCGGACGATCTGCCTACGGAGTTTGATGTTGTCATCCTCGGAACTGGCCTTCCCGAGTCCATCATTGCTGCCGCATGCACCAGAACTGGGCAACAGGTCCTTCATGTAGATGCGAGAAATTACTATGGTGGGAATTGGGCCAGCTTTACATTTTCAGGGTTACAGACCTGGATTGAAAACTGTAAGCAAGAACCGAACACTGATTTCGCTGAATCATGTAAGGGTCAAGCTTTAGACAACGAAGAAATAATTCCATTCAACAAGAGAAACCAAACCATTCAGAATGTTGAGGTCTTCTGTTACTCCAGTACTGAAGATGGAGAAAACATTGAAGAAGCCGGAGTACTTAACCTAAACCCTGCACTGCTAACCACTGTTACCACTTCAGCAGATTCTGAGTCAGCTAGTCAAGAGAACGCCTCTATAGATATTTGTAAAAATTACAAATCTACAGAAACAGAAAAGCATGACAGTCCTGAAGGTAGAAGTGATCTGGAAGAGGCAGCAAGTCATGACCAAGGGTCAGCAGATTCTACTCCAGAGACCGGTGCCACAGAAGAGGTGGAACCATTCCCAACACAGGCCAATCAGCAGGACTCGCCGAANACTGTTACTTATTCCCAGATTGTGAAGGAAGGAAGAAGATTTAATATTGATTTAGTGTCAAAGTTTCTGTATTCCCGAGGAATGTTAATTGAGCTGCTCATCAAATCAAATGTTAGTCGTTACACCGAGTTTTAAGATGGTTACCCCGGATTTTAACGTATCAACATGAAAAAATTGAAGCAGGTACTTTGGTCCAGGAGCAAAAGTATTTGCTAATTAAACACCTTTTCCTGGGGTA
Full Trace Sequence: AATGATTTTTAATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGATCTGCCTACGGAGTTTGATGTTGTCATCCTCGGAACTGGCCTTCCCGAGTCCATCATTGCTGCCGCATGCACCAGAACTGGGCAACAGGTCCTTCATGTAGATGCGAGAAATTACTATGGTGGGAATTGGGCCAGCTTTACATTTTCAGGGTTACAGACCTGGATTGAAAACTGTAAGCAAGAACCGAACACTGATTTCGCTGAATCATGTAAGGGTCAAGCTTTAGACAACGAAGAAATAATTCCATTCAACAAGAGAAACCAAACCATTCAGAATGTTGAGGTCTTCTGTTACTCCAGTACTGAAGATGGAGAAAACATTGAAGAAGCCGGAGTACTTAACCTAAACCCTGCACTGCTAACCACTGTTACCACTTCAGCAGATTCTGAGTCAGCTAGTCAAGAGAACGCCTCTATAGATATTTGTAAAAATTACAAATCTACAGAAACAGAAAAGCATGACAGTCCTGAAGGTAGAAGTGATCTGGAAGAGGCAGCAAGTCATGACCAAGGGTCAGCAGATTCTACTCCAGAGACCGGTGCCACAGAAGAGGTGGAACCATTCCCAACACAGGCCAATCAGCAGGACTCGCCGAANACTGTTACTTATTCCCAGATTGTGAAGGAAGGAAGAAGATTTAATATTGATTTAGTGTCAAAGTTTCTGTATTCCCGAGGAATGTTAATTGAGCTGCTCATCAAATCAAATGTTAGTCGTTACACCGAGTTTTAAGATGGTTACCCCGGATTTTAACGTATCAACATGAAAAAATTGAAGCAGGTACTTTGGTCCAGGAGCAAAAGTATTTGCTAATTAAACACCTTTTCCTGGGGTA
Primer Sequence: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGACGATCTGCCT

Sequences - 3ʹ (reverse) EST

Accession: JZ830164
dbEST ID: 79647866
Trimmed Sequence: TTCTGCCTTCTGTCCTTCTAAGTCTTCACATGATTCTGTTACAGTTTCAGCGGAAGCCTCTGCTTTTACAGGAATGCTCGATTCACTTGCTTCTTGCTGAACACACTCTCCATCATAGATAATATCTTCTGGGTTTGGAGCTGGTGGGCAGAATTCCTCACTTGGATAAAGATCGTGGAATATATTTTCTGCCTGCTGGACCGCATGATCATTTCCAAAGCAATGATCTGGCCCACTGCAAACATACACGTTTGAAGGAAGTCCAACATATGATTGGCGCGGAACACCAGAGGAATCCCTCATATTAAAATACAGAGCCCAAAGAACTTTTGGTTTTGTGATGTCACTTGTTTCAAGATCTTTCTCTGTGCTCAGAGTAAATAATTGTTGTACAACTGGTTCCAGATCTTCTTTGGCTGTTGCTTTTGTGGATGAACATGTAAGATGGACAACGTATGTGTTTTTCATGCAAGTCATTGTTGATGAGCAGAGTTCAGTTAAGTAGACAGCATTTTGTCCGTCTGCTGGTGGGAATGTCAAAACTGAAATCTCTTGGTTTGATTCCGAGTTCAGTATAGAACAGTCTGTAATAAGGACTGCTCGGGAGAATTGTTTGTATGATACATTTGCACAGATCTGCTCAGGAAGGTAGCTATCCTCCCACACCAGGTATTTGCAGTCTACTCGGTTTACCTCTGTGGTCAATGACAGCTTTTACATAAGCTTTGAATCCTCCATCGAACAACCAAGGCACTTCCCAGCC
Full Trace Sequence: ACGTGTAAACAGCTATGACCATGTAATACGACTCACTATAGGGGATATCAGCTGGATGGCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATAAGCAATGCTTTCTTATAATGCCAACTTTGTACAAGAAAGTTGGCAATTCTGCCTTCTGTCCTTCTAAGTCTTCACATGATTCTGTTACAGTTTCAGCGGAAGCCTCTGCTTTTACAGGAATGCTCGATTCACTTGCTTCTTGCTGAACACACTCTCCATCATAGATAATATCTTCTGGGTTTGGAGCTGGTGGGCAGAATTCCTCACTTGGATAAAGATCGTGGAATATATTTTCTGCCTGCTGGACCGCATGATCATTTCCAAAGCAATGATCTGGCCCACTGCAAACATACACGTTTGAAGGAAGTCCAACATATGATTGGCGCGGAACACCAGAGGAATCCCTCATATTAAAATACAGAGCCCAAAGAACTTTTGGTTTTGTGATGTCACTTGTTTCAAGATCTTTCTCTGTGCTCAGAGTAAATAATTGTTGTACAACTGGTTCCAGATCTTCTTTGGCTGTTGCTTTTGTGGATGAACATGTAAGATGGACAACGTATGTGTTTTTCATGCAAGTCATTGTTGATGAGCAGAGTTCAGTTAAGTAGACAGCATTTTGTCCGTCTGCTGGTGGGAATGTCAAAACTGAAATCTCTTGGTTTGATTCCGAGTTCAGTATAGAACAGTCTGTAATAAGGACTGCTCGGGAGAATTGTTTGTATGATACATTTGCACAGATCTGCTCAGGAAGGTAGCTATCCTCCCACACCAGGTATTTGCAGTCTACTCGGTTTACCTCTGTGGTCAATGACAGCTTTTACATAAGCTTTGAATCCTCCATCGAACAACCAAGGCACTTCCCAGCC
Primer Sequence: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTGCCTTCTGTCCTTCT